| Variant ID: vg0314577463 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14577463 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 113. )
TTTTTGGCTAGCTTTGCCATGCCGTCCCGCCCCTCTCAGGGGAATCCTTTTTTTTTTTGTCTTTACTCGTGTGCACGAAGTTCACTTCGTGATCGGTCAT[C/T,A]
CATCCTGAAATTGCTCCAGACCAAACACGCTTAATATCAAAGTTCTTTGGAGATCGGCTTCCGAAAGAGTAGTTGTAACTTGTTGGTATAAGTATTCTAT
ATAGAATACTTATACCAACAAGTTACAACTACTCTTTCGGAAGCCGATCTCCAAAGAACTTTGATATTAAGCGTGTTTGGTCTGGAGCAATTTCAGGATG[G/A,T]
ATGACCGATCACGAAGTGAACTTCGTGCACACGAGTAAAGACAAAAAAAAAAAGGATTCCCCTGAGAGGGGCGGGACGGCATGGCAAAGCTAGCCAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.20% | 13.00% | 2.43% | 13.31% | A: 0.02% |
| All Indica | 2759 | 58.40% | 19.70% | 3.26% | 18.70% | NA |
| All Japonica | 1512 | 99.30% | 0.20% | 0.20% | 0.26% | A: 0.07% |
| Aus | 269 | 37.50% | 19.70% | 6.69% | 36.06% | NA |
| Indica I | 595 | 53.30% | 19.80% | 5.71% | 21.18% | NA |
| Indica II | 465 | 26.70% | 41.30% | 4.52% | 27.53% | NA |
| Indica III | 913 | 80.30% | 6.10% | 1.31% | 12.27% | NA |
| Indica Intermediate | 786 | 55.50% | 22.50% | 2.93% | 19.08% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.40% | 0.83% | 1.24% | A: 0.41% |
| VI/Aromatic | 96 | 93.80% | 2.10% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 70.00% | 16.70% | 3.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314577463 | C -> T | LOC_Os03g25510.1 | upstream_gene_variant ; 2688.0bp to feature; MODIFIER | silent_mutation | Average:43.003; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0314577463 | C -> T | LOC_Os03g25530.1 | upstream_gene_variant ; 1076.0bp to feature; MODIFIER | silent_mutation | Average:43.003; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0314577463 | C -> T | LOC_Os03g25510-LOC_Os03g25530 | intergenic_region ; MODIFIER | silent_mutation | Average:43.003; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0314577463 | C -> A | LOC_Os03g25510.1 | upstream_gene_variant ; 2688.0bp to feature; MODIFIER | silent_mutation | Average:43.003; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0314577463 | C -> A | LOC_Os03g25530.1 | upstream_gene_variant ; 1076.0bp to feature; MODIFIER | silent_mutation | Average:43.003; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0314577463 | C -> A | LOC_Os03g25510-LOC_Os03g25530 | intergenic_region ; MODIFIER | silent_mutation | Average:43.003; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0314577463 | C -> DEL | N | N | silent_mutation | Average:43.003; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314577463 | NA | 8.07E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314577463 | 2.85E-52 | 3.67E-118 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314577463 | 2.22E-41 | 3.46E-60 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314577463 | NA | 2.34E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314577463 | NA | 3.01E-09 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314577463 | 6.23E-62 | 3.23E-139 | mr1542_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314577463 | 1.98E-57 | 2.99E-74 | mr1542_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314577463 | 1.59E-19 | 7.50E-35 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314577463 | 9.40E-13 | 9.06E-18 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314577463 | NA | 6.19E-10 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |