\
| Variant ID: vg0314576905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14576905 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 105. )
CATCTCCACGCCCGCTACGAAACCGCAGGAGGCGCACCCGCGGGCCCTCACCCCAGCCAAGAAGAAGCAAGAGACCAAGCCTGACCCCGCTAGGAAGCGA[C/T]
GGCGGTGGCGCGGCTTCATCTTCATTCGTGTGTCGCCTCACTAGTGGTCACTAGAATGGATACTATCATCTCAATCGGGCGGCAACTCCCATCTCAATCG
CGATTGAGATGGGAGTTGCCGCCCGATTGAGATGATAGTATCCATTCTAGTGACCACTAGTGAGGCGACACACGAATGAAGATGAAGCCGCGCCACCGCC[G/A]
TCGCTTCCTAGCGGGGTCAGGCTTGGTCTCTTGCTTCTTCTTGGCTGGGGTGAGGGCCCGCGGGTGCGCCTCCTGCGGTTTCGTAGCGGGCGTGGAGATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.20% | 28.10% | 0.13% | 0.55% | NA |
| All Indica | 2759 | 58.20% | 40.70% | 0.14% | 0.91% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.30% | 45.40% | 0.34% | 1.01% | NA |
| Indica II | 465 | 26.50% | 72.50% | 0.00% | 1.08% | NA |
| Indica III | 913 | 80.30% | 19.20% | 0.00% | 0.55% | NA |
| Indica Intermediate | 786 | 55.20% | 43.40% | 0.25% | 1.15% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 27.80% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314576905 | C -> T | LOC_Os03g25510.1 | upstream_gene_variant ; 2130.0bp to feature; MODIFIER | silent_mutation | Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0314576905 | C -> T | LOC_Os03g25530.1 | upstream_gene_variant ; 1634.0bp to feature; MODIFIER | silent_mutation | Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0314576905 | C -> T | LOC_Os03g25510-LOC_Os03g25530 | intergenic_region ; MODIFIER | silent_mutation | Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0314576905 | C -> DEL | N | N | silent_mutation | Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314576905 | 1.26E-50 | 2.68E-119 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576905 | 6.20E-38 | 6.14E-61 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576905 | NA | 4.03E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576905 | NA | 1.02E-09 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576905 | 2.85E-59 | 5.75E-142 | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576905 | 1.31E-49 | 1.58E-76 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576905 | 1.37E-20 | 4.45E-35 | mr1587_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576905 | 1.00E-13 | 4.05E-18 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576905 | NA | 1.92E-10 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |