\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314576905:

Variant ID: vg0314576905 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14576905
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTCCACGCCCGCTACGAAACCGCAGGAGGCGCACCCGCGGGCCCTCACCCCAGCCAAGAAGAAGCAAGAGACCAAGCCTGACCCCGCTAGGAAGCGA[C/T]
GGCGGTGGCGCGGCTTCATCTTCATTCGTGTGTCGCCTCACTAGTGGTCACTAGAATGGATACTATCATCTCAATCGGGCGGCAACTCCCATCTCAATCG

Reverse complement sequence

CGATTGAGATGGGAGTTGCCGCCCGATTGAGATGATAGTATCCATTCTAGTGACCACTAGTGAGGCGACACACGAATGAAGATGAAGCCGCGCCACCGCC[G/A]
TCGCTTCCTAGCGGGGTCAGGCTTGGTCTCTTGCTTCTTCTTGGCTGGGGTGAGGGCCCGCGGGTGCGCCTCCTGCGGTTTCGTAGCGGGCGTGGAGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 28.10% 0.13% 0.55% NA
All Indica  2759 58.20% 40.70% 0.14% 0.91% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 37.50% 62.50% 0.00% 0.00% NA
Indica I  595 53.30% 45.40% 0.34% 1.01% NA
Indica II  465 26.50% 72.50% 0.00% 1.08% NA
Indica III  913 80.30% 19.20% 0.00% 0.55% NA
Indica Intermediate  786 55.20% 43.40% 0.25% 1.15% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 68.90% 27.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314576905 C -> T LOC_Os03g25510.1 upstream_gene_variant ; 2130.0bp to feature; MODIFIER silent_mutation Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0314576905 C -> T LOC_Os03g25530.1 upstream_gene_variant ; 1634.0bp to feature; MODIFIER silent_mutation Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0314576905 C -> T LOC_Os03g25510-LOC_Os03g25530 intergenic_region ; MODIFIER silent_mutation Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0314576905 C -> DEL N N silent_mutation Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314576905 1.26E-50 2.68E-119 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905 6.20E-38 6.14E-61 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905 NA 4.03E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905 NA 1.02E-09 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905 2.85E-59 5.75E-142 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905 1.31E-49 1.58E-76 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905 1.37E-20 4.45E-35 mr1587_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905 1.00E-13 4.05E-18 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905 NA 1.92E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251