Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0314576860:

Variant ID: vg0314576860 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14576860
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCCTCGTCGGCTGCGGCATCACGCTACTCGTCTGCCACTCCTCCATCTCCACGCCCGCTACGAAACCGCAGGAGGCGCACCCGCGGGCCCTCACCCCA[G/A]
CCAAGAAGAAGCAAGAGACCAAGCCTGACCCCGCTAGGAAGCGACGGCGGTGGCGCGGCTTCATCTTCATTCGTGTGTCGCCTCACTAGTGGTCACTAGA

Reverse complement sequence

TCTAGTGACCACTAGTGAGGCGACACACGAATGAAGATGAAGCCGCGCCACCGCCGTCGCTTCCTAGCGGGGTCAGGCTTGGTCTCTTGCTTCTTCTTGG[C/T]
TGGGGTGAGGGCCCGCGGGTGCGCCTCCTGCGGTTTCGTAGCGGGCGTGGAGATGGAGGAGTGGCAGACGAGTAGCGTGATGCCGCAGCCGACGAGGACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	7.40%	0.00%	0.00%	NA
All Indica	2759	90.90%	9.10%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	66.20%	33.80%	0.00%	0.00%	NA
Indica I	595	91.30%	8.70%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	88.50%	11.50%	0.00%	0.00%	NA
Indica Intermediate	786	88.90%	11.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314576860	G -> A	LOC_Os03g25510.1	upstream_gene_variant ; 2085.0bp to feature; MODIFIER	silent_mutation	Average:69.52; most accessible tissue: Minghui63 flag leaf, score: 83.412	N	N	N	N
vg0314576860	G -> A	LOC_Os03g25530.1	upstream_gene_variant ; 1679.0bp to feature; MODIFIER	silent_mutation	Average:69.52; most accessible tissue: Minghui63 flag leaf, score: 83.412	N	N	N	N
vg0314576860	G -> A	LOC_Os03g25510-LOC_Os03g25530	intergenic_region ; MODIFIER	silent_mutation	Average:69.52; most accessible tissue: Minghui63 flag leaf, score: 83.412	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314576860	NA	4.68E-06	Awn_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314576860	NA	2.48E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860	1.26E-08	NA	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860	NA	6.18E-06	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860	NA	9.39E-08	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860	7.53E-06	7.54E-06	mr1673	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860	NA	7.40E-06	mr1673	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860	1.20E-11	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860	4.67E-08	NA	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860	7.49E-09	4.88E-19	mr1587_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251