\
| Variant ID: vg0314576860 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14576860 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGTCCTCGTCGGCTGCGGCATCACGCTACTCGTCTGCCACTCCTCCATCTCCACGCCCGCTACGAAACCGCAGGAGGCGCACCCGCGGGCCCTCACCCCA[G/A]
CCAAGAAGAAGCAAGAGACCAAGCCTGACCCCGCTAGGAAGCGACGGCGGTGGCGCGGCTTCATCTTCATTCGTGTGTCGCCTCACTAGTGGTCACTAGA
TCTAGTGACCACTAGTGAGGCGACACACGAATGAAGATGAAGCCGCGCCACCGCCGTCGCTTCCTAGCGGGGTCAGGCTTGGTCTCTTGCTTCTTCTTGG[C/T]
TGGGGTGAGGGCCCGCGGGTGCGCCTCCTGCGGTTTCGTAGCGGGCGTGGAGATGGAGGAGTGGCAGACGAGTAGCGTGATGCCGCAGCCGACGAGGACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 66.20% | 33.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314576860 | G -> A | LOC_Os03g25510.1 | upstream_gene_variant ; 2085.0bp to feature; MODIFIER | silent_mutation | Average:69.52; most accessible tissue: Minghui63 flag leaf, score: 83.412 | N | N | N | N |
| vg0314576860 | G -> A | LOC_Os03g25530.1 | upstream_gene_variant ; 1679.0bp to feature; MODIFIER | silent_mutation | Average:69.52; most accessible tissue: Minghui63 flag leaf, score: 83.412 | N | N | N | N |
| vg0314576860 | G -> A | LOC_Os03g25510-LOC_Os03g25530 | intergenic_region ; MODIFIER | silent_mutation | Average:69.52; most accessible tissue: Minghui63 flag leaf, score: 83.412 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314576860 | NA | 4.68E-06 | Awn_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314576860 | NA | 2.48E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576860 | 1.26E-08 | NA | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576860 | NA | 6.18E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576860 | NA | 9.39E-08 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576860 | 7.53E-06 | 7.54E-06 | mr1673 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576860 | NA | 7.40E-06 | mr1673 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576860 | 1.20E-11 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576860 | 4.67E-08 | NA | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314576860 | 7.49E-09 | 4.88E-19 | mr1587_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |