\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314576860:

Variant ID: vg0314576860 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14576860
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCCTCGTCGGCTGCGGCATCACGCTACTCGTCTGCCACTCCTCCATCTCCACGCCCGCTACGAAACCGCAGGAGGCGCACCCGCGGGCCCTCACCCCA[G/A]
CCAAGAAGAAGCAAGAGACCAAGCCTGACCCCGCTAGGAAGCGACGGCGGTGGCGCGGCTTCATCTTCATTCGTGTGTCGCCTCACTAGTGGTCACTAGA

Reverse complement sequence

TCTAGTGACCACTAGTGAGGCGACACACGAATGAAGATGAAGCCGCGCCACCGCCGTCGCTTCCTAGCGGGGTCAGGCTTGGTCTCTTGCTTCTTCTTGG[C/T]
TGGGGTGAGGGCCCGCGGGTGCGCCTCCTGCGGTTTCGTAGCGGGCGTGGAGATGGAGGAGTGGCAGACGAGTAGCGTGATGCCGCAGCCGACGAGGACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.40% 0.00% 0.00% NA
All Indica  2759 90.90% 9.10% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 66.20% 33.80% 0.00% 0.00% NA
Indica I  595 91.30% 8.70% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 88.50% 11.50% 0.00% 0.00% NA
Indica Intermediate  786 88.90% 11.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314576860 G -> A LOC_Os03g25510.1 upstream_gene_variant ; 2085.0bp to feature; MODIFIER silent_mutation Average:69.52; most accessible tissue: Minghui63 flag leaf, score: 83.412 N N N N
vg0314576860 G -> A LOC_Os03g25530.1 upstream_gene_variant ; 1679.0bp to feature; MODIFIER silent_mutation Average:69.52; most accessible tissue: Minghui63 flag leaf, score: 83.412 N N N N
vg0314576860 G -> A LOC_Os03g25510-LOC_Os03g25530 intergenic_region ; MODIFIER silent_mutation Average:69.52; most accessible tissue: Minghui63 flag leaf, score: 83.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314576860 NA 4.68E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314576860 NA 2.48E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860 1.26E-08 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860 NA 6.18E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860 NA 9.39E-08 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860 7.53E-06 7.54E-06 mr1673 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860 NA 7.40E-06 mr1673 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860 1.20E-11 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860 4.67E-08 NA mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576860 7.49E-09 4.88E-19 mr1587_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251