Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314576155:

Variant ID: vg0314576155 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14576155
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

TGACTCCTGGTTTGGAATGGATAATTCCTGGTTTGGAGGTTTGATCTATACGACCGGGGTTGGTTGTTCAGGTTTGGTTGGGCCTATGCAGCATGGGTGT[A/G]
CTGTTCAGTGTTGATTAAAATTTCTGATTAATTACTCTACTGTTTTACTTCTCTTAAATGTTTGCTAAATGCTATTTCGCAAATGAACCCTATATTATGC

Reverse complement sequence

GCATAATATAGGGTTCATTTGCGAAATAGCATTTAGCAAACATTTAAGAGAAGTAAAACAGTAGAGTAATTAATCAGAAATTTTAATCAACACTGAACAG[T/C]
ACACCCATGCTGCATAGGCCCAACCAAACCTGAACAACCAACCCCGGTCGTATAGATCAAACCTCCAAACCAGGAATTATCCATTCCAAACCAGGAGTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.40%	31.20%	0.34%	0.00%	NA
All Indica	2759	53.90%	45.80%	0.29%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	33.80%	63.20%	2.97%	0.00%	NA
Indica I	595	50.80%	48.90%	0.34%	0.00%	NA
Indica II	465	21.30%	78.70%	0.00%	0.00%	NA
Indica III	913	76.70%	23.20%	0.11%	0.00%	NA
Indica Intermediate	786	49.10%	50.30%	0.64%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314576155	A -> G	LOC_Os03g25510.1	upstream_gene_variant ; 1380.0bp to feature; MODIFIER	silent_mutation	Average:39.071; most accessible tissue: Zhenshan97 flag leaf, score: 56.01	N	N	N	N
vg0314576155	A -> G	LOC_Os03g25530.1	upstream_gene_variant ; 2384.0bp to feature; MODIFIER	silent_mutation	Average:39.071; most accessible tissue: Zhenshan97 flag leaf, score: 56.01	N	N	N	N
vg0314576155	A -> G	LOC_Os03g25500.1	downstream_gene_variant ; 4392.0bp to feature; MODIFIER	silent_mutation	Average:39.071; most accessible tissue: Zhenshan97 flag leaf, score: 56.01	N	N	N	N
vg0314576155	A -> G	LOC_Os03g25510-LOC_Os03g25530	intergenic_region ; MODIFIER	silent_mutation	Average:39.071; most accessible tissue: Zhenshan97 flag leaf, score: 56.01	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314576155	1.95E-73	6.64E-160	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576155	5.93E-58	8.06E-95	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576155	NA	3.16E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576155	NA	1.62E-09	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576155	6.50E-07	2.10E-20	mr1281_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576155	2.21E-06	2.21E-06	mr1281_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576155	8.47E-83	6.57E-189	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576155	5.90E-82	4.46E-119	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576155	1.07E-18	3.38E-31	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576155	2.69E-13	2.28E-15	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251