\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314575975:

Variant ID: vg0314575975 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14575975
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGTGGTATTACGGGGCATGGCAACATGTGTGGAATCGTGTCTTGTGGGTACAGTGGTACACCTCTGGCTAGAGTAAAACTATTCGAATAGCCGTGCCC[G/A]
CGGTCATGGGCGAGTTGAGCAATGTTTTTCGTGATTAGTCCCATACTACTCAATAATGTTAATAATGTGATAATTAATTTGACTCCTGGTTTGGAATGGA

Reverse complement sequence

TCCATTCCAAACCAGGAGTCAAATTAATTATCACATTATTAACATTATTGAGTAGTATGGGACTAATCACGAAAAACATTGCTCAACTCGCCCATGACCG[C/T]
GGGCACGGCTATTCGAATAGTTTTACTCTAGCCAGAGGTGTACCACTGTACCCACAAGACACGATTCCACACATGTTGCCATGCCCCGTAATACCACCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 1.70% 7.91% 0.00% NA
All Indica  2759 85.50% 2.50% 12.03% 0.00% NA
All Japonica  1512 99.80% 0.00% 0.20% 0.00% NA
Aus  269 85.50% 3.30% 11.15% 0.00% NA
Indica I  595 78.50% 1.50% 20.00% 0.00% NA
Indica II  465 66.90% 7.10% 26.02% 0.00% NA
Indica III  913 98.10% 0.70% 1.20% 0.00% NA
Indica Intermediate  786 87.20% 2.50% 10.31% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 86.70% 4.40% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314575975 G -> A LOC_Os03g25510.1 upstream_gene_variant ; 1200.0bp to feature; MODIFIER silent_mutation Average:52.765; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0314575975 G -> A LOC_Os03g25530.1 upstream_gene_variant ; 2564.0bp to feature; MODIFIER silent_mutation Average:52.765; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0314575975 G -> A LOC_Os03g25500.1 downstream_gene_variant ; 4212.0bp to feature; MODIFIER silent_mutation Average:52.765; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0314575975 G -> A LOC_Os03g25510-LOC_Os03g25530 intergenic_region ; MODIFIER silent_mutation Average:52.765; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314575975 NA 2.18E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314575975 9.98E-07 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314575975 5.08E-06 9.89E-14 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314575975 1.61E-06 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314575975 4.19E-06 1.73E-15 mr1542_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251