Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314575975:

Variant ID: vg0314575975 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14575975
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGTGGTATTACGGGGCATGGCAACATGTGTGGAATCGTGTCTTGTGGGTACAGTGGTACACCTCTGGCTAGAGTAAAACTATTCGAATAGCCGTGCCC[G/A]
CGGTCATGGGCGAGTTGAGCAATGTTTTTCGTGATTAGTCCCATACTACTCAATAATGTTAATAATGTGATAATTAATTTGACTCCTGGTTTGGAATGGA

Reverse complement sequence

TCCATTCCAAACCAGGAGTCAAATTAATTATCACATTATTAACATTATTGAGTAGTATGGGACTAATCACGAAAAACATTGCTCAACTCGCCCATGACCG[C/T]
GGGCACGGCTATTCGAATAGTTTTACTCTAGCCAGAGGTGTACCACTGTACCCACAAGACACGATTCCACACATGTTGCCATGCCCCGTAATACCACCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.40%	1.70%	7.91%	0.00%	NA
All Indica	2759	85.50%	2.50%	12.03%	0.00%	NA
All Japonica	1512	99.80%	0.00%	0.20%	0.00%	NA
Aus	269	85.50%	3.30%	11.15%	0.00%	NA
Indica I	595	78.50%	1.50%	20.00%	0.00%	NA
Indica II	465	66.90%	7.10%	26.02%	0.00%	NA
Indica III	913	98.10%	0.70%	1.20%	0.00%	NA
Indica Intermediate	786	87.20%	2.50%	10.31%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	86.70%	4.40%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314575975	G -> A	LOC_Os03g25510.1	upstream_gene_variant ; 1200.0bp to feature; MODIFIER	silent_mutation	Average:52.765; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0314575975	G -> A	LOC_Os03g25530.1	upstream_gene_variant ; 2564.0bp to feature; MODIFIER	silent_mutation	Average:52.765; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0314575975	G -> A	LOC_Os03g25500.1	downstream_gene_variant ; 4212.0bp to feature; MODIFIER	silent_mutation	Average:52.765; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0314575975	G -> A	LOC_Os03g25510-LOC_Os03g25530	intergenic_region ; MODIFIER	silent_mutation	Average:52.765; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314575975	NA	2.18E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314575975	9.98E-07	NA	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314575975	5.08E-06	9.89E-14	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314575975	1.61E-06	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314575975	4.19E-06	1.73E-15	mr1542_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251