\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314568077:

Variant ID: vg0314568077 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 14568077
Reference Allele: TAlternative Allele: A,TCTCA,TCA,TCACA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGTTGCTGTTCTTGCGTTTGGCTCTTTCTTTGTTGGAAGCATTTGCACCAAGGGAATTTTGATGCTACTTGTCAATCTCTCTCCTCTCTCTCTCTCTC[T/A,TCTCA,TCA,TCACA]
CACACACAGACACACACAATCAATCAAGTAGTATCTATCAGTGCTAAATACTACTCCCACGTCTCATTATAAATGCAACTATAAGTTTCCGTCCAACGTT

Reverse complement sequence

AACGTTGGACGGAAACTTATAGTTGCATTTATAATGAGACGTGGGAGTAGTATTTAGCACTGATAGATACTACTTGATTGATTGTGTGTGTCTGTGTGTG[A/T,TGAGA,TGA,TGTGA]
GAGAGAGAGAGAGAGGAGAGAGATTGACAAGTAGCATCAAAATTCCCTTGGTGCAAATGCTTCCAACAAAGAAAGAGCCAAACGCAAGAACAGCAACAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 12.70% 2.58% 0.51% TCTCA: 12.25%; TCA: 0.21%; TCACA: 0.06%
All Indica  2759 55.70% 21.10% 4.17% 0.87% TCTCA: 17.83%; TCA: 0.29%; TCACA: 0.07%
All Japonica  1512 99.50% 0.20% 0.07% 0.00% TCTCA: 0.26%
Aus  269 71.00% 1.50% 0.37% 0.00% TCTCA: 26.02%; TCA: 0.74%; TCACA: 0.37%
Indica I  595 50.80% 9.60% 3.36% 0.50% TCTCA: 35.46%; TCA: 0.34%
Indica II  465 22.40% 33.80% 4.09% 1.94% TCTCA: 37.42%; TCA: 0.43%
Indica III  913 78.50% 16.10% 3.29% 0.44% TCTCA: 1.64%
Indica Intermediate  786 52.50% 28.10% 5.85% 1.02% TCTCA: 11.70%; TCA: 0.51%; TCACA: 0.25%
Temperate Japonica  767 99.50% 0.30% 0.13% 0.00% TCTCA: 0.13%
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 0.00% TCTCA: 1.24%
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 71.10% 10.00% 4.44% 0.00% TCTCA: 14.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314568077 T -> TCA LOC_Os03g25500.1 intron_variant ; MODIFIER silent_mutation Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246 N N N N
vg0314568077 T -> TCACA LOC_Os03g25500.1 intron_variant ; MODIFIER silent_mutation Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246 N N N N
vg0314568077 T -> DEL N N silent_mutation Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246 N N N N
vg0314568077 T -> A LOC_Os03g25500.1 intron_variant ; MODIFIER silent_mutation Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246 N N N N
vg0314568077 T -> TCTCA LOC_Os03g25500.1 intron_variant ; MODIFIER silent_mutation Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314568077 T A -0.03 -0.02 -0.01 0.0 0.02 0.03
vg0314568077 T TCA 0.08 0.25 0.19 -0.2 -0.09 -0.08
vg0314568077 T TCACA 0.2 0.45 0.39 0.22 0.2 0.02
vg0314568077 T TCTCA 0.25 0.46 0.39 0.23 0.24 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314568077 2.02E-18 1.72E-59 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077 8.74E-21 1.48E-38 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077 3.08E-06 2.66E-11 mr1902 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077 4.16E-22 2.91E-66 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077 1.03E-27 1.29E-45 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077 3.64E-06 NA mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077 1.22E-06 3.68E-11 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077 NA 3.46E-12 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077 NA 5.72E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251