Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314567314:

Variant ID: vg0314567314 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14567314
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTCCTTCCTGTAGTACCACGCGGTATAGAGGCTGTGTCAGCCGTTTGATGGGGCTAGATGGACGGCCACGATTCGGTACCGCATAGGGTCAAGGACA[G/A]
TAAAAAATATCTCCAATGTGTGAATCAAAATACACTATAGGTCGGTCTCAGTCTCTTAGACCTTGATATACCACCACCATCAACCACCGAAATGACCTGG

Reverse complement sequence

CCAGGTCATTTCGGTGGTTGATGGTGGTGGTATATCAAGGTCTAAGAGACTGAGACCGACCTATAGTGTATTTTGATTCACACATTGGAGATATTTTTTA[C/T]
TGTCCTTGACCCTATGCGGTACCGAATCGTGGCCGTCCATCTAGCCCCATCAAACGGCTGACACAGCCTCTATACCGCGTGGTACTACAGGAAGGAACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.80% 20.60% 0.00% 0.59% NA
All Indica  2759 67.50% 31.50% 0.00% 0.98% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 72.50% 27.50% 0.00% 0.00% NA
Indica I  595 62.20% 36.80% 0.00% 1.01% NA
Indica II  465 28.00% 71.00% 0.00% 1.08% NA
Indica III  913 91.80% 7.60% 0.00% 0.66% NA
Indica Intermediate  786 66.70% 32.10% 0.00% 1.27% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314567314 G -> A LOC_Os03g25500.1 upstream_gene_variant ; 178.0bp to feature; MODIFIER silent_mutation Average:80.508; most accessible tissue: Minghui63 flag leaf, score: 95.943 N N N N
vg0314567314 G -> A LOC_Os03g25490-LOC_Os03g25500 intergenic_region ; MODIFIER silent_mutation Average:80.508; most accessible tissue: Minghui63 flag leaf, score: 95.943 N N N N
vg0314567314 G -> DEL N N silent_mutation Average:80.508; most accessible tissue: Minghui63 flag leaf, score: 95.943 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314567314 G A 0.05 0.05 0.06 0.02 0.08 0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314567314 NA 1.23E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 2.20E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 1.49E-08 mr1298 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 2.31E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 4.19E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 8.68E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 2.85E-28 4.55E-72 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 1.98E-26 1.52E-41 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 5.65E-07 mr1731 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 4.61E-09 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 4.44E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 6.87E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 8.49E-31 1.36E-78 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 5.48E-33 5.40E-47 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 5.79E-09 NA mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 3.79E-08 8.27E-11 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314567314 NA 4.67E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251