Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314544054:

Variant ID: vg0314544054 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14544054
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GACCTGATCAAGCTGCTGCCGAGCGGCACGGTGTTCCTCTTCCAGTTCCTCAGCCCGCTCGTCACCAACAACGGCCACTGCGCCGCCGCCTACAGCAGGG[T/C]
CCTCAGCGCCGCCCTCCTCGCGCTCTGCGGCGCCTTCTGCGCCTTCTCCTCCTTCACCGACAGCTACGTCGGCTCCGACGGCCGCGTCTACTACGGCGTC

Reverse complement sequence

GACGCCGTAGTAGACGCGGCCGTCGGAGCCGACGTAGCTGTCGGTGAAGGAGGAGAAGGCGCAGAAGGCGCCGCAGAGCGCGAGGAGGGCGGCGCTGAGG[A/G]
CCCTGCTGTAGGCGGCGGCGCAGTGGCCGTTGTTGGTGACGAGCGGGCTGAGGAACTGGAAGAGGAACACCGTGCCGCTCGGCAGCAGCTTGATCAGGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 16.10% 0.00% 0.00% NA
All Indica  2759 85.90% 14.10% 0.00% 0.00% NA
All Japonica  1512 84.10% 15.90% 0.00% 0.00% NA
Aus  269 57.60% 42.40% 0.00% 0.00% NA
Indica I  595 87.70% 12.30% 0.00% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 84.90% 15.10% 0.00% 0.00% NA
Indica Intermediate  786 81.70% 18.30% 0.00% 0.00% NA
Temperate Japonica  767 82.00% 18.00% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 8.30% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 25.30% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314544054 T -> C LOC_Os03g25440.1 missense_variant ; p.Val54Ala; MODERATE nonsynonymous_codon ; V54A Average:86.028; most accessible tissue: Zhenshan97 flower, score: 92.866 benign -0.148 TOLERATED 0.13

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314544054 T C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314544054 NA 5.52E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 3.84E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 7.75E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 1.89E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 1.56E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 6.83E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 5.00E-08 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 8.23E-10 NA mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 3.77E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 8.23E-08 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 2.35E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 3.56E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 2.13E-10 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 6.24E-12 NA mr1542_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 6.58E-11 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314544054 NA 9.27E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251