Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314542570:

Variant ID: vg0314542570 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14542570
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 42. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAGATACCCGATGATGGTAATAGTATGTAGATATAGAAGGATTAGATAAAAGGACTAGGGAGAGGGAGCTGAGAGTAGCGGCACTCAATAGTGCAGTG[A/C]
AGTTGGGGTGTAGTGGACTAGTTTGTGAATTTTTTCTATATAAACTATTCTTTGGTCTTATAGTGAGTAACTTACAAAACTCAAAACTAGTTAACGGAAA

Reverse complement sequence

TTTCCGTTAACTAGTTTTGAGTTTTGTAAGTTACTCACTATAAGACCAAAGAATAGTTTATATAGAAAAAATTCACAAACTAGTCCACTACACCCCAACT[T/G]
CACTGCACTATTGAGTGCCGCTACTCTCAGCTCCCTCTCCCTAGTCCTTTTATCTAATCCTTCTATATCTACATACTATTACCATCATCGGGTATCTCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	36.90%	0.28%	0.21%	NA
All Indica	2759	53.40%	45.90%	0.36%	0.36%	NA
All Japonica	1512	83.70%	16.30%	0.00%	0.00%	NA
Aus	269	29.70%	69.90%	0.37%	0.00%	NA
Indica I	595	49.20%	50.10%	0.50%	0.17%	NA
Indica II	465	20.60%	78.50%	0.43%	0.43%	NA
Indica III	913	77.00%	22.70%	0.00%	0.33%	NA
Indica Intermediate	786	48.30%	50.50%	0.64%	0.51%	NA
Temperate Japonica	767	82.00%	18.00%	0.00%	0.00%	NA
Tropical Japonica	504	91.50%	8.50%	0.00%	0.00%	NA
Japonica Intermediate	241	73.00%	27.00%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314542570	A -> C	LOC_Os03g25430.1	upstream_gene_variant ; 2961.0bp to feature; MODIFIER	silent_mutation	Average:46.745; most accessible tissue: Callus, score: 78.753	N	N	N	N
vg0314542570	A -> C	LOC_Os03g25440.1	upstream_gene_variant ; 1180.0bp to feature; MODIFIER	silent_mutation	Average:46.745; most accessible tissue: Callus, score: 78.753	N	N	N	N
vg0314542570	A -> C	LOC_Os03g25450.1	upstream_gene_variant ; 3145.0bp to feature; MODIFIER	silent_mutation	Average:46.745; most accessible tissue: Callus, score: 78.753	N	N	N	N
vg0314542570	A -> C	LOC_Os03g25434.1	intron_variant ; MODIFIER	silent_mutation	Average:46.745; most accessible tissue: Callus, score: 78.753	N	N	N	N
vg0314542570	A -> DEL	N	N	silent_mutation	Average:46.745; most accessible tissue: Callus, score: 78.753	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314542570	8.56E-06	8.56E-06	mr1418	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314542570	6.20E-06	4.70E-06	mr1492	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314542570	1.13E-06	1.13E-06	mr1506	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314542570	6.03E-37	1.76E-106	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314542570	8.77E-46	1.04E-82	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314542570	NA	2.12E-08	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314542570	2.80E-41	3.96E-121	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314542570	2.62E-64	4.23E-100	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314542570	8.92E-13	6.36E-24	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314542570	6.60E-12	8.54E-14	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251