\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314533547:

Variant ID: vg0314533547 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14533547
Reference Allele: TAlternative Allele: G,C
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, G: 0.30, A: 0.03, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAAGAAACTAGGAGAGAGAGAAGAACATGAAACATAAAGGGAGAAATGGGTGATGATTTCACATAAAAACTACAGCTTCTAGAAGTTAAACGGTTTAG[T/G,C]
GAGCATCTAATTATAGAAGAAGCTGCGGTAACTAGAAACTCCCCCGGACAGACCCTGTGTCTTTGCGTAGCCGTGCCCTTATCGATTTCTTAGTGTGGAA

Reverse complement sequence

TTCCACACTAAGAAATCGATAAGGGCACGGCTACGCAAAGACACAGGGTCTGTCCGGGGGAGTTTCTAGTTACCGCAGCTTCTTCTATAATTAGATGCTC[A/C,G]
CTAAACCGTTTAACTTCTAGAAGCTGTAGTTTTTATGTGAAATCATCACCCATTTCTCCCTTTATGTTTCATGTTCTTCTCTCTCTCCTAGTTTCTTCGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 31.70% 0.34% 0.23% NA
All Indica  2759 53.40% 45.70% 0.47% 0.40% NA
All Japonica  1512 99.30% 0.60% 0.07% 0.00% NA
Aus  269 30.10% 69.50% 0.37% 0.00% NA
Indica I  595 49.40% 49.70% 0.67% 0.17% NA
Indica II  465 20.40% 78.90% 0.22% 0.43% NA
Indica III  913 77.70% 22.00% 0.11% 0.22% NA
Indica Intermediate  786 47.70% 50.60% 0.89% 0.76% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 7.30% 1.04% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314533547 T -> C LOC_Os03g25410.1 upstream_gene_variant ; 2238.0bp to feature; MODIFIER N Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> C LOC_Os03g25420.1 upstream_gene_variant ; 245.0bp to feature; MODIFIER N Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> C LOC_Os03g25400.1 downstream_gene_variant ; 2696.0bp to feature; MODIFIER N Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> C LOC_Os03g25430.1 downstream_gene_variant ; 4583.0bp to feature; MODIFIER N Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> C LOC_Os03g25410-LOC_Os03g25420 intergenic_region ; MODIFIER N Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> DEL N N silent_mutation Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> G LOC_Os03g25410.1 upstream_gene_variant ; 2238.0bp to feature; MODIFIER silent_mutation Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> G LOC_Os03g25420.1 upstream_gene_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> G LOC_Os03g25400.1 downstream_gene_variant ; 2696.0bp to feature; MODIFIER silent_mutation Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> G LOC_Os03g25430.1 downstream_gene_variant ; 4583.0bp to feature; MODIFIER silent_mutation Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N
vg0314533547 T -> G LOC_Os03g25410-LOC_Os03g25420 intergenic_region ; MODIFIER silent_mutation Average:95.895; most accessible tissue: Callus, score: 98.338 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314533547 T C 0.0 0.02 0.01 0.01 0.01 0.0
vg0314533547 T G 0.01 0.01 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314533547 1.16E-67 2.37E-153 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533547 2.48E-53 3.54E-93 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533547 NA 1.82E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533547 7.89E-06 1.52E-09 mr1902 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533547 NA 5.52E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533547 NA 4.78E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533547 5.05E-79 6.54E-182 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533547 1.79E-79 4.68E-119 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533547 3.42E-17 3.87E-28 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314533547 6.23E-13 2.66E-14 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251