Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0314502491:

Variant ID: vg0314502491 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14502491
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, A: 0.24, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATTAGCCCTTAGAGAGCCGCTACTCCTACTTCAGCTCTCTGACTCGGCTCAGCCAACCTCGCTACCACCGGTGGTGAAGTGGAGGTCTTCCATGTCA[A/T]
CCCGCCATGGCATCACCAAGGTTGTGCCTATCAACGAGGAGGCACATGCATCATCGGTATCCCTTGTGCTTGGGCAGAGGTGCTTCGTCGACAATGACTT

Reverse complement sequence

AAGTCATTGTCGACGAAGCACCTCTGCCCAAGCACAAGGGATACCGATGATGCATGTGCCTCCTCGTTGATAGGCACAACCTTGGTGATGCCATGGCGGG[T/A]
TGACATGGAAGACCTCCACTTCACCACCGGTGGTAGCGAGGTTGGCTGAGCCGAGTCAGAGAGCTGAAGTAGGAGTAGCGGCTCTCTAAGGGCTAATAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 40.70% 4.02% 3.89% NA
All Indica  2759 80.90% 6.30% 6.67% 6.13% NA
All Japonica  1512 0.50% 99.40% 0.00% 0.13% NA
Aus  269 53.90% 42.00% 0.37% 3.72% NA
Indica I  595 96.30% 3.40% 0.17% 0.17% NA
Indica II  465 69.50% 0.00% 14.62% 15.91% NA
Indica III  913 83.60% 10.20% 4.05% 2.19% NA
Indica Intermediate  786 72.90% 7.80% 9.92% 9.41% NA
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 0.40% 99.40% 0.00% 0.20% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 86.50% 1.04% 2.08% NA
Intermediate  90 40.00% 54.40% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314502491 A -> T LOC_Os03g25364.1 missense_variant ; p.Thr167Ser; MODERATE nonsynonymous_codon ; T167S Average:74.541; most accessible tissue: Zhenshan97 panicle, score: 91.374 unknown unknown DELETERIOUS 0.00
vg0314502491 A -> DEL LOC_Os03g25364.1 N frameshift_variant Average:74.541; most accessible tissue: Zhenshan97 panicle, score: 91.374 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314502491 A T 0.0 -0.01 -0.01 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314502491 4.17E-07 NA mr1244 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251