\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314491238:

Variant ID: vg0314491238 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14491238
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, C: 0.26, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCTTAGCAAAATAAATTTCACGCCCTCTAATTTGGGACGAAGGGAGTATATCTTATAGATATAGTATATATCAATACAATTAATAACTTCTATGCAAG[C/A]
ATTTAATGTATGAGATAGTGTTATATCTTACAGGTATGCAATATATGTATATATCAATGCAATTAATAATTTCTACACAAGAATTTAATGTATAAGATAT

Reverse complement sequence

ATATCTTATACATTAAATTCTTGTGTAGAAATTATTAATTGCATTGATATATACATATATTGCATACCTGTAAGATATAACACTATCTCATACATTAAAT[G/T]
CTTGCATAGAAGTTATTAATTGTATTGATATATACTATATCTATAAGATATACTCCCTTCGTCCCAAATTAGAGGGCGTGAAATTTATTTTGCTAAGACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 49.20% 0.53% 0.02% NA
All Indica  2759 61.40% 37.90% 0.58% 0.04% NA
All Japonica  1512 36.40% 63.40% 0.20% 0.00% NA
Aus  269 30.50% 68.80% 0.74% 0.00% NA
Indica I  595 57.50% 42.40% 0.17% 0.00% NA
Indica II  465 28.60% 70.80% 0.65% 0.00% NA
Indica III  913 82.40% 17.10% 0.55% 0.00% NA
Indica Intermediate  786 59.50% 39.40% 0.89% 0.13% NA
Temperate Japonica  767 67.30% 32.50% 0.26% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 9.50% 90.00% 0.41% 0.00% NA
VI/Aromatic  96 14.60% 84.40% 1.04% 0.00% NA
Intermediate  90 36.70% 60.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314491238 C -> A LOC_Os03g25350.1 upstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:31.04; most accessible tissue: Callus, score: 65.683 N N N N
vg0314491238 C -> A LOC_Os03g25360.1 upstream_gene_variant ; 3640.0bp to feature; MODIFIER silent_mutation Average:31.04; most accessible tissue: Callus, score: 65.683 N N N N
vg0314491238 C -> A LOC_Os03g25340-LOC_Os03g25350 intergenic_region ; MODIFIER silent_mutation Average:31.04; most accessible tissue: Callus, score: 65.683 N N N N
vg0314491238 C -> DEL N N silent_mutation Average:31.04; most accessible tissue: Callus, score: 65.683 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314491238 NA 6.31E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 5.18E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 1.28E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 1.64E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 2.63E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 5.98E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 1.03E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 6.88E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 2.56E-14 NA mr1542 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 6.67E-17 1.22E-25 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 8.25E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 2.21E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 7.97E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 3.02E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 6.13E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 2.52E-17 NA mr1542_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 2.95E-20 5.51E-29 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 3.26E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314491238 NA 8.78E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251