\
| Variant ID: vg0314488405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14488405 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, others allele: 0.00, population size: 92. )
TGGGAGTAGTATTACTTGTACTTTTCTCTGTACAGTTTTTTCTCTGATGGAAATAGATGGGAGTACACAATTTCTTATGGCTATTGTACTTCTCACCTCA[G/A]
GATAAAAAAAAACCCTTATATTTCTGGACAAATTAAGGAGACATAATCCCCTATATTTCTGGACGGAGGGAGTATCTAATACTACCTCCGTTTTAGGTTA
TAACCTAAAACGGAGGTAGTATTAGATACTCCCTCCGTCCAGAAATATAGGGGATTATGTCTCCTTAATTTGTCCAGAAATATAAGGGTTTTTTTTTATC[C/T]
TGAGGTGAGAAGTACAATAGCCATAAGAAATTGTGTACTCCCATCTATTTCCATCAGAGAAAAAACTGTACAGAGAAAAGTACAAGTAATACTACTCCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 28.20% | 0.15% | 0.04% | NA |
| All Indica | 2759 | 75.70% | 24.10% | 0.07% | 0.07% | NA |
| All Japonica | 1512 | 63.50% | 36.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 65.80% | 34.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 56.30% | 43.50% | 0.00% | 0.17% | NA |
| Indica II | 465 | 58.90% | 40.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.20% | 17.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 32.50% | 67.00% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314488405 | G -> A | LOC_Os03g25350.1 | upstream_gene_variant ; 3331.0bp to feature; MODIFIER | silent_mutation | Average:25.199; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg0314488405 | G -> A | LOC_Os03g25340-LOC_Os03g25350 | intergenic_region ; MODIFIER | silent_mutation | Average:25.199; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg0314488405 | G -> DEL | N | N | silent_mutation | Average:25.199; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314488405 | NA | 6.88E-12 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | 4.29E-10 | NA | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | 1.02E-11 | 6.11E-16 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | NA | 8.25E-08 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | NA | 2.21E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | NA | 6.13E-12 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | 7.21E-08 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | 1.02E-12 | 3.21E-17 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | 1.50E-06 | NA | mr1587_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | 2.56E-06 | 1.05E-06 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314488405 | NA | 8.78E-07 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |