\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314488405:

Variant ID: vg0314488405 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14488405
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGAGTAGTATTACTTGTACTTTTCTCTGTACAGTTTTTTCTCTGATGGAAATAGATGGGAGTACACAATTTCTTATGGCTATTGTACTTCTCACCTCA[G/A]
GATAAAAAAAAACCCTTATATTTCTGGACAAATTAAGGAGACATAATCCCCTATATTTCTGGACGGAGGGAGTATCTAATACTACCTCCGTTTTAGGTTA

Reverse complement sequence

TAACCTAAAACGGAGGTAGTATTAGATACTCCCTCCGTCCAGAAATATAGGGGATTATGTCTCCTTAATTTGTCCAGAAATATAAGGGTTTTTTTTTATC[C/T]
TGAGGTGAGAAGTACAATAGCCATAAGAAATTGTGTACTCCCATCTATTTCCATCAGAGAAAAAACTGTACAGAGAAAAGTACAAGTAATACTACTCCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 28.20% 0.15% 0.04% NA
All Indica  2759 75.70% 24.10% 0.07% 0.07% NA
All Japonica  1512 63.50% 36.20% 0.26% 0.00% NA
Aus  269 65.80% 34.20% 0.00% 0.00% NA
Indica I  595 56.30% 43.50% 0.00% 0.17% NA
Indica II  465 58.90% 40.90% 0.00% 0.22% NA
Indica III  913 91.30% 8.70% 0.00% 0.00% NA
Indica Intermediate  786 82.20% 17.60% 0.25% 0.00% NA
Temperate Japonica  767 32.50% 67.00% 0.52% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314488405 G -> A LOC_Os03g25350.1 upstream_gene_variant ; 3331.0bp to feature; MODIFIER silent_mutation Average:25.199; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0314488405 G -> A LOC_Os03g25340-LOC_Os03g25350 intergenic_region ; MODIFIER silent_mutation Average:25.199; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0314488405 G -> DEL N N silent_mutation Average:25.199; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314488405 NA 6.88E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 4.29E-10 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 1.02E-11 6.11E-16 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 NA 8.25E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 NA 2.21E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 NA 6.13E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 7.21E-08 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 1.02E-12 3.21E-17 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 1.50E-06 NA mr1587_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 2.56E-06 1.05E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314488405 NA 8.78E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251