Variant ID: vg0314437380 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 14437380 |
Reference Allele: G | Alternative Allele: C |
Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTCCACGCGGGGGCACGACTGCTTGTAGTAGCCCAGCTGCAGGCCGTGGCACGCCGACGCGAGCGCCAGCGCGCACGCCACCGCCATGGCGAGCTTCATG[G/C]
CCGATGCTGCCATTGTCTTCTCTGCTGCTTCCTTGCTGGAAGAGAAGAGATGATCGATGGACTGCCTGCTTCTGCTTCTGCTGTCTGCTGATCGTATACA
TGTATACGATCAGCAGACAGCAGAAGCAGAAGCAGGCAGTCCATCGATCATCTCTTCTCTTCCAGCAAGGAAGCAGCAGAGAAGACAATGGCAGCATCGG[C/G]
CATGAAGCTCGCCATGGCGGTGGCGTGCGCGCTGGCGCTCGCGTCGGCGTGCCACGGCCTGCAGCTGGGCTACTACAAGCAGTCGTGCCCCCGCGTGGAG
Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 39.80% | 60.20% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0314437380 | G -> C | LOC_Os03g25280.1 | missense_variant ; p.Ala5Gly; MODERATE | nonsynonymous_codon ; A5G | Average:42.095; most accessible tissue: Zhenshan97 root, score: 59.664 | unknown | unknown | TOLERATED | 0.32 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0314437380 | NA | 4.85E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0314437380 | NA | 8.66E-16 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0314437380 | NA | 4.87E-11 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0314437380 | NA | 1.98E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314437380 | NA | 5.41E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314437380 | NA | 7.29E-11 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314437380 | NA | 1.84E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314437380 | NA | 2.43E-09 | mr1548 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314437380 | NA | 1.28E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0314437380 | 3.81E-06 | 1.32E-27 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/