RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0314437380:

Variant ID: vg0314437380 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14437380
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCACGCGGGGGCACGACTGCTTGTAGTAGCCCAGCTGCAGGCCGTGGCACGCCGACGCGAGCGCCAGCGCGCACGCCACCGCCATGGCGAGCTTCATG[G/C]
CCGATGCTGCCATTGTCTTCTCTGCTGCTTCCTTGCTGGAAGAGAAGAGATGATCGATGGACTGCCTGCTTCTGCTTCTGCTGTCTGCTGATCGTATACA

Reverse complement sequence

TGTATACGATCAGCAGACAGCAGAAGCAGAAGCAGGCAGTCCATCGATCATCTCTTCTCTTCCAGCAAGGAAGCAGCAGAGAAGACAATGGCAGCATCGG[C/G]
CATGAAGCTCGCCATGGCGGTGGCGTGCGCGCTGGCGCTCGCGTCGGCGTGCCACGGCCTGCAGCTGGGCTACTACAAGCAGTCGTGCCCCCGCGTGGAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	10.70%	0.00%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	67.30%	32.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	39.80%	60.20%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	90.50%	9.50%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314437380	G -> C	LOC_Os03g25280.1	missense_variant ; p.Ala5Gly; MODERATE	nonsynonymous_codon ; A5G	Average:42.095; most accessible tissue: Zhenshan97 root, score: 59.664	unknown	unknown	TOLERATED	0.32

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314437380	NA	4.85E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314437380	NA	8.66E-16	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314437380	NA	4.87E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314437380	NA	1.98E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314437380	NA	5.41E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314437380	NA	7.29E-11	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314437380	NA	1.84E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314437380	NA	2.43E-09	mr1548	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314437380	NA	1.28E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314437380	3.81E-06	1.32E-27	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 17 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0314437380:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact