\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314426110:

Variant ID: vg0314426110 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14426110
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


ACACATTTTATTTTGGTTATTTCAGGGAACCTATGAATGTCATATTGATCTTGAAGACATTATTTGTCATCACAATGTGAGAATGATTAGACAATACAAT[G/T]
TCTAGATATATACTGTTAACAACTTTCAGCTGAATCAGTTTATCTTGCAGAATACTTTAACATAAAATGGCAAATGCCTAAGGTGGTATTGCTCCTTCAA

Reverse complement sequence

TTGAAGGAGCAATACCACCTTAGGCATTTGCCATTTTATGTTAAAGTATTCTGCAAGATAAACTGATTCAGCTGAAAGTTGTTAACAGTATATATCTAGA[C/A]
ATTGTATTGTCTAATCATTCTCACATTGTGATGACAAATAATGTCTTCAAGATCAATATGACATTCATAGGTTCCCTGAAATAACCAAAATAAAATGTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 49.40% 0.11% 0.00% NA
All Indica  2759 19.90% 79.90% 0.18% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 69.90% 30.10% 0.00% 0.00% NA
Indica I  595 19.30% 80.20% 0.50% 0.00% NA
Indica II  465 3.00% 97.00% 0.00% 0.00% NA
Indica III  913 26.30% 73.50% 0.22% 0.00% NA
Indica Intermediate  786 23.00% 77.00% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314426110 G -> T LOC_Os03g25250.1 upstream_gene_variant ; 1779.0bp to feature; MODIFIER silent_mutation Average:37.581; most accessible tissue: Callus, score: 55.275 N N N N
vg0314426110 G -> T LOC_Os03g25260.1 intron_variant ; MODIFIER silent_mutation Average:37.581; most accessible tissue: Callus, score: 55.275 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314426110 NA 1.76E-31 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 NA 3.56E-09 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 NA 2.25E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 NA 1.41E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 NA 4.39E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 3.65E-06 1.15E-54 mr1798 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 5.19E-06 5.66E-13 mr1798 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 NA 4.11E-33 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 NA 6.31E-06 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 NA 7.41E-16 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 NA 2.28E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314426110 NA 1.07E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251