\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314422675:

Variant ID: vg0314422675 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14422675
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


ACCATCGATTCCGTCCAAACTATTGTTCTTTGATGTGGAATGAATCCCTCCAAATACACTTGATTATTGTTTCGAATTATAGTTGCAAAGTGTTAACTTT[T/C]
GAAGTTAATTTTAACTTGCATGTTTGTGTAGTGATATATTACATATTGATCTATCTTGTTAATTTTTTTGAAAATTTTTCGTAACCATCTAGTTGATATG

Reverse complement sequence

CATATCAACTAGATGGTTACGAAAAATTTTCAAAAAAATTAACAAGATAGATCAATATGTAATATATCACTACACAAACATGCAAGTTAAAATTAACTTC[A/G]
AAAGTTAACACTTTGCAACTATAATTCGAAACAATAATCAAGTGTATTTGGAGGGATTCATTCCACATCAAAGAACAATAGTTTGGACGGAATCGATGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 49.30% 0.08% 0.00% NA
All Indica  2759 81.90% 18.00% 0.04% 0.00% NA
All Japonica  1512 0.60% 99.40% 0.00% 0.00% NA
Aus  269 30.10% 69.50% 0.37% 0.00% NA
Indica I  595 83.90% 16.00% 0.17% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 75.90% 24.10% 0.00% 0.00% NA
Indica Intermediate  786 78.90% 21.10% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314422675 T -> C LOC_Os03g25260.1 upstream_gene_variant ; 1954.0bp to feature; MODIFIER silent_mutation Average:37.396; most accessible tissue: Callus, score: 65.347 N N N N
vg0314422675 T -> C LOC_Os03g25240.1 downstream_gene_variant ; 2313.0bp to feature; MODIFIER silent_mutation Average:37.396; most accessible tissue: Callus, score: 65.347 N N N N
vg0314422675 T -> C LOC_Os03g25250.1 downstream_gene_variant ; 307.0bp to feature; MODIFIER silent_mutation Average:37.396; most accessible tissue: Callus, score: 65.347 N N N N
vg0314422675 T -> C LOC_Os03g25240-LOC_Os03g25250 intergenic_region ; MODIFIER silent_mutation Average:37.396; most accessible tissue: Callus, score: 65.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314422675 3.23E-06 5.31E-33 mr1037 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 1.37E-09 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 7.58E-37 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 7.30E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 8.54E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 7.09E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 9.76E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 9.19E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 2.23E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 6.64E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 7.90E-52 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 6.58E-09 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 3.08E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 3.16E-06 3.16E-06 mr1926 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 9.23E-34 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675 NA 3.11E-08 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251