Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314422675:

Variant ID: vg0314422675 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14422675
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

ACCATCGATTCCGTCCAAACTATTGTTCTTTGATGTGGAATGAATCCCTCCAAATACACTTGATTATTGTTTCGAATTATAGTTGCAAAGTGTTAACTTT[T/C]
GAAGTTAATTTTAACTTGCATGTTTGTGTAGTGATATATTACATATTGATCTATCTTGTTAATTTTTTTGAAAATTTTTCGTAACCATCTAGTTGATATG

Reverse complement sequence

CATATCAACTAGATGGTTACGAAAAATTTTCAAAAAAATTAACAAGATAGATCAATATGTAATATATCACTACACAAACATGCAAGTTAAAATTAACTTC[A/G]
AAAGTTAACACTTTGCAACTATAATTCGAAACAATAATCAAGTGTATTTGGAGGGATTCATTCCACATCAAAGAACAATAGTTTGGACGGAATCGATGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	49.30%	0.08%	0.00%	NA
All Indica	2759	81.90%	18.00%	0.04%	0.00%	NA
All Japonica	1512	0.60%	99.40%	0.00%	0.00%	NA
Aus	269	30.10%	69.50%	0.37%	0.00%	NA
Indica I	595	83.90%	16.00%	0.17%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	75.90%	24.10%	0.00%	0.00%	NA
Indica Intermediate	786	78.90%	21.10%	0.00%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	38.90%	58.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314422675	T -> C	LOC_Os03g25260.1	upstream_gene_variant ; 1954.0bp to feature; MODIFIER	silent_mutation	Average:37.396; most accessible tissue: Callus, score: 65.347	N	N	N	N
vg0314422675	T -> C	LOC_Os03g25240.1	downstream_gene_variant ; 2313.0bp to feature; MODIFIER	silent_mutation	Average:37.396; most accessible tissue: Callus, score: 65.347	N	N	N	N
vg0314422675	T -> C	LOC_Os03g25250.1	downstream_gene_variant ; 307.0bp to feature; MODIFIER	silent_mutation	Average:37.396; most accessible tissue: Callus, score: 65.347	N	N	N	N
vg0314422675	T -> C	LOC_Os03g25240-LOC_Os03g25250	intergenic_region ; MODIFIER	silent_mutation	Average:37.396; most accessible tissue: Callus, score: 65.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314422675	3.23E-06	5.31E-33	mr1037	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	1.37E-09	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	7.58E-37	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	7.30E-23	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	8.54E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	7.09E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	9.76E-12	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	9.19E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	2.23E-09	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	6.64E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	7.90E-52	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	6.58E-09	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	3.08E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	3.16E-06	3.16E-06	mr1926	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	9.23E-34	mr1037_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314422675	NA	3.11E-08	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251