\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314396350:

Variant ID: vg0314396350 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14396350
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TGCATGACTAAATTTAATCTACAATAAGAGAAACAAAAATAATAAAATCAGATAGTGAATACCTGTACAGCGTAGATAAAATTTATTATTTTTGTTTTTC[A/C]
TATGTCGATCGAATTTATACCTTTTTTTTTTCAAGTGTCTTATATTATTATAGTCTATTTTATCAAATTTTTTGAAATTTTTATATAACTGTTTAAATTA

Reverse complement sequence

TAATTTAAACAGTTATATAAAAATTTCAAAAAATTTGATAAAATAGACTATAATAATATAAGACACTTGAAAAAAAAAAGGTATAAATTCGATCGACATA[T/G]
GAAAAACAAAAATAATAAATTTTATCTACGCTGTACAGGTATTCACTATCTGATTTTATTATTTTTGTTTCTCTTATTGTAGATTAAATTTAGTCATGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 40.90% 0.15% 7.51% NA
All Indica  2759 21.90% 65.10% 0.22% 12.79% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 64.30% 35.70% 0.00% 0.00% NA
Indica I  595 39.00% 49.10% 0.34% 11.60% NA
Indica II  465 41.10% 56.10% 0.00% 2.80% NA
Indica III  913 6.20% 74.50% 0.22% 19.06% NA
Indica Intermediate  786 15.80% 71.60% 0.25% 12.34% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 68.90% 27.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314396350 A -> C LOC_Os03g25170.1 upstream_gene_variant ; 2481.0bp to feature; MODIFIER silent_mutation Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 N N N N
vg0314396350 A -> C LOC_Os03g25180.1 upstream_gene_variant ; 600.0bp to feature; MODIFIER silent_mutation Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 N N N N
vg0314396350 A -> C LOC_Os03g25190.1 upstream_gene_variant ; 700.0bp to feature; MODIFIER silent_mutation Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 N N N N
vg0314396350 A -> C LOC_Os03g25180-LOC_Os03g25190 intergenic_region ; MODIFIER silent_mutation Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 N N N N
vg0314396350 A -> DEL N N silent_mutation Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314396350 1.10E-11 NA mr1542 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350 5.07E-09 2.33E-12 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350 2.49E-12 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350 1.46E-10 2.55E-15 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350 1.15E-07 NA mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350 NA 3.03E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350 NA 8.49E-07 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251