\
| Variant ID: vg0314396350 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14396350 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 117. )
TGCATGACTAAATTTAATCTACAATAAGAGAAACAAAAATAATAAAATCAGATAGTGAATACCTGTACAGCGTAGATAAAATTTATTATTTTTGTTTTTC[A/C]
TATGTCGATCGAATTTATACCTTTTTTTTTTCAAGTGTCTTATATTATTATAGTCTATTTTATCAAATTTTTTGAAATTTTTATATAACTGTTTAAATTA
TAATTTAAACAGTTATATAAAAATTTCAAAAAATTTGATAAAATAGACTATAATAATATAAGACACTTGAAAAAAAAAAGGTATAAATTCGATCGACATA[T/G]
GAAAAACAAAAATAATAAATTTTATCTACGCTGTACAGGTATTCACTATCTGATTTTATTATTTTTGTTTCTCTTATTGTAGATTAAATTTAGTCATGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.40% | 40.90% | 0.15% | 7.51% | NA |
| All Indica | 2759 | 21.90% | 65.10% | 0.22% | 12.79% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 64.30% | 35.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 39.00% | 49.10% | 0.34% | 11.60% | NA |
| Indica II | 465 | 41.10% | 56.10% | 0.00% | 2.80% | NA |
| Indica III | 913 | 6.20% | 74.50% | 0.22% | 19.06% | NA |
| Indica Intermediate | 786 | 15.80% | 71.60% | 0.25% | 12.34% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 27.80% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314396350 | A -> C | LOC_Os03g25170.1 | upstream_gene_variant ; 2481.0bp to feature; MODIFIER | silent_mutation | Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 | N | N | N | N |
| vg0314396350 | A -> C | LOC_Os03g25180.1 | upstream_gene_variant ; 600.0bp to feature; MODIFIER | silent_mutation | Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 | N | N | N | N |
| vg0314396350 | A -> C | LOC_Os03g25190.1 | upstream_gene_variant ; 700.0bp to feature; MODIFIER | silent_mutation | Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 | N | N | N | N |
| vg0314396350 | A -> C | LOC_Os03g25180-LOC_Os03g25190 | intergenic_region ; MODIFIER | silent_mutation | Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 | N | N | N | N |
| vg0314396350 | A -> DEL | N | N | silent_mutation | Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314396350 | 1.10E-11 | NA | mr1542 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314396350 | 5.07E-09 | 2.33E-12 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314396350 | 2.49E-12 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314396350 | 1.46E-10 | 2.55E-15 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314396350 | 1.15E-07 | NA | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314396350 | NA | 3.03E-06 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314396350 | NA | 8.49E-07 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |