Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314396350:

Variant ID: vg0314396350 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14396350
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TGCATGACTAAATTTAATCTACAATAAGAGAAACAAAAATAATAAAATCAGATAGTGAATACCTGTACAGCGTAGATAAAATTTATTATTTTTGTTTTTC[A/C]
TATGTCGATCGAATTTATACCTTTTTTTTTTCAAGTGTCTTATATTATTATAGTCTATTTTATCAAATTTTTTGAAATTTTTATATAACTGTTTAAATTA

Reverse complement sequence

TAATTTAAACAGTTATATAAAAATTTCAAAAAATTTGATAAAATAGACTATAATAATATAAGACACTTGAAAAAAAAAAGGTATAAATTCGATCGACATA[T/G]
GAAAAACAAAAATAATAAATTTTATCTACGCTGTACAGGTATTCACTATCTGATTTTATTATTTTTGTTTCTCTTATTGTAGATTAAATTTAGTCATGCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.40%	40.90%	0.15%	7.51%	NA
All Indica	2759	21.90%	65.10%	0.22%	12.79%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	64.30%	35.70%	0.00%	0.00%	NA
Indica I	595	39.00%	49.10%	0.34%	11.60%	NA
Indica II	465	41.10%	56.10%	0.00%	2.80%	NA
Indica III	913	6.20%	74.50%	0.22%	19.06%	NA
Indica Intermediate	786	15.80%	71.60%	0.25%	12.34%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	68.90%	27.80%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314396350	A -> C	LOC_Os03g25170.1	upstream_gene_variant ; 2481.0bp to feature; MODIFIER	silent_mutation	Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247	N	N	N	N
vg0314396350	A -> C	LOC_Os03g25180.1	upstream_gene_variant ; 600.0bp to feature; MODIFIER	silent_mutation	Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247	N	N	N	N
vg0314396350	A -> C	LOC_Os03g25190.1	upstream_gene_variant ; 700.0bp to feature; MODIFIER	silent_mutation	Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247	N	N	N	N
vg0314396350	A -> C	LOC_Os03g25180-LOC_Os03g25190	intergenic_region ; MODIFIER	silent_mutation	Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247	N	N	N	N
vg0314396350	A -> DEL	N	N	silent_mutation	Average:75.776; most accessible tissue: Zhenshan97 flower, score: 88.247	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314396350	1.10E-11	NA	mr1542	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350	5.07E-09	2.33E-12	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350	2.49E-12	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350	1.46E-10	2.55E-15	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350	1.15E-07	NA	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350	NA	3.03E-06	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314396350	NA	8.49E-07	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251