\
| Variant ID: vg0314344500 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14344500 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.08, others allele: 0.00, population size: 245. )
GACATCCAATTAATACATACTAGCACAGTACTGTACTTGTGTGTCCTAAAACAAAAATATGTTTTATTCTACACATATAACATCAACCAAGGAAACATAA[T/A]
AGAGAAAAAGTTTGATTTGAAAGATATCTTTTCCATCATATTTTCCTATGCTGCAAGCTAGATGGATCTTCAAACCAATGGCGCCTCTATTAATTCAATA
TATTGAATTAATAGAGGCGCCATTGGTTTGAAGATCCATCTAGCTTGCAGCATAGGAAAATATGATGGAAAAGATATCTTTCAAATCAAACTTTTTCTCT[A/T]
TTATGTTTCCTTGGTTGATGTTATATGTGTAGAATAAAACATATTTTTGTTTTAGGACACACAAGTACAGTACTGTGCTAGTATGTATTAATTGGATGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 49.70% | 0.11% | 0.28% | NA |
| All Indica | 2759 | 79.70% | 19.70% | 0.11% | 0.47% | NA |
| All Japonica | 1512 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 43.10% | 56.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 64.20% | 35.10% | 0.00% | 0.67% | NA |
| Indica II | 465 | 58.70% | 40.20% | 0.22% | 0.86% | NA |
| Indica III | 913 | 95.50% | 4.30% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 85.50% | 13.90% | 0.13% | 0.51% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 68.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314344500 | T -> A | LOC_Os03g25110.1 | downstream_gene_variant ; 2792.0bp to feature; MODIFIER | silent_mutation | Average:45.543; most accessible tissue: Callus, score: 87.266 | N | N | N | N |
| vg0314344500 | T -> A | LOC_Os03g25120.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.543; most accessible tissue: Callus, score: 87.266 | N | N | N | N |
| vg0314344500 | T -> DEL | N | N | silent_mutation | Average:45.543; most accessible tissue: Callus, score: 87.266 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314344500 | NA | 2.38E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | NA | 1.87E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | 4.44E-09 | NA | mr1542 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | 7.65E-08 | 1.00E-11 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | NA | 3.70E-07 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | NA | 6.23E-06 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | 8.67E-11 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | 2.04E-10 | 2.15E-14 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | 4.48E-08 | NA | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | NA | 9.84E-06 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314344500 | NA | 1.11E-07 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |