\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314275748:

Variant ID: vg0314275748 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14275748
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTAACTAGGCTTAAATGTCAACCGATCTCCACTTTTCGGGGGTGCTAATAGGCGCGTACGCGCCAGCAATTTAGCTGGCGCGCGCGTCAGCCGGGCC[T/C]
CTCCCCGTGTCTTTTTTTCGCTATTTTTCTTTTTTTCGTACTTTTTTTCCTGATTTTGGCTCGCATGCTTTCCTTTTTTTTTCTCCGTTTCTTTTCGATT

Reverse complement sequence

AATCGAAAAGAAACGGAGAAAAAAAAAGGAAAGCATGCGAGCCAAAATCAGGAAAAAAAGTACGAAAAAAAGAAAAATAGCGAAAAAAAGACACGGGGAG[A/G]
GGCCCGGCTGACGCGCGCGCCAGCTAAATTGCTGGCGCGTACGCGCCTATTAGCACCCCCGAAAAGTGGAGATCGGTTGACATTTAAGCCTAGTTAATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.80% 5.40% 4.06% 52.81% NA
All Indica  2759 2.60% 6.00% 6.13% 85.25% NA
All Japonica  1512 99.40% 0.00% 0.07% 0.53% NA
Aus  269 29.40% 31.20% 7.06% 32.34% NA
Indica I  595 0.50% 1.30% 11.93% 86.22% NA
Indica II  465 0.40% 0.90% 10.11% 88.60% NA
Indica III  913 4.20% 11.50% 1.42% 82.91% NA
Indica Intermediate  786 3.70% 6.20% 4.83% 85.24% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 98.30% 0.00% 0.41% 1.24% NA
VI/Aromatic  96 85.40% 1.00% 0.00% 13.54% NA
Intermediate  90 54.40% 2.20% 3.33% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314275748 T -> C LOC_Os03g25010.1 upstream_gene_variant ; 727.0bp to feature; MODIFIER silent_mutation Average:39.876; most accessible tissue: Zhenshan97 root, score: 68.908 N N N N
vg0314275748 T -> C LOC_Os03g25000.1 downstream_gene_variant ; 3811.0bp to feature; MODIFIER silent_mutation Average:39.876; most accessible tissue: Zhenshan97 root, score: 68.908 N N N N
vg0314275748 T -> C LOC_Os03g25000-LOC_Os03g25010 intergenic_region ; MODIFIER silent_mutation Average:39.876; most accessible tissue: Zhenshan97 root, score: 68.908 N N N N
vg0314275748 T -> DEL N N silent_mutation Average:39.876; most accessible tissue: Zhenshan97 root, score: 68.908 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314275748 NA 1.08E-38 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 1.71E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 7.70E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 3.06E-75 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 2.09E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 1.18E-40 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 8.78E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 6.16E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 7.43E-20 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 2.66E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 1.13E-72 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 1.07E-77 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 1.47E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 3.68E-58 mr1795 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 1.15E-53 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 1.36E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 4.54E-41 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 2.65E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 1.25E-14 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 5.89E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 3.10E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 5.27E-24 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314275748 NA 5.63E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251