\
| Variant ID: vg0314274098 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14274098 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 109. )
TGAGGACGCTTCAACCTCAAACAACACGTACTTCTCTCTTACCTCCTACGCAAGATCGAACGGGACACGCTTCCACGTTAAGGCCGGGACACACACCAGC[A/G]
CTAGCAGCAGGTCCGCCGAGCCCGTCCTCCTCCGGTCCTCCCTCCAAGTTGCGGAATTGAGATGCGATGGGCCGGCCGATGGCACAAACGAAACCGCTGC
GCAGCGGTTTCGTTTGTGCCATCGGCCGGCCCATCGCATCTCAATTCCGCAACTTGGAGGGAGGACCGGAGGAGGACGGGCTCGGCGGACCTGCTGCTAG[T/C]
GCTGGTGTGTGTCCCGGCCTTAACGTGGAAGCGTGTCCCGTTCGATCTTGCGTAGGAGGTAAGAGAGAAGTACGTGTTGTTTGAGGTTGAAGCGTCCTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 17.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 70.40% | 29.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 64.60% | 35.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 70.40% | 29.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314274098 | A -> G | LOC_Os03g25010.1 | upstream_gene_variant ; 2377.0bp to feature; MODIFIER | silent_mutation | Average:76.628; most accessible tissue: Callus, score: 84.679 | N | N | N | N |
| vg0314274098 | A -> G | LOC_Os03g25000.1 | downstream_gene_variant ; 2161.0bp to feature; MODIFIER | silent_mutation | Average:76.628; most accessible tissue: Callus, score: 84.679 | N | N | N | N |
| vg0314274098 | A -> G | LOC_Os03g25000-LOC_Os03g25010 | intergenic_region ; MODIFIER | silent_mutation | Average:76.628; most accessible tissue: Callus, score: 84.679 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314274098 | NA | 5.41E-15 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314274098 | NA | 5.27E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | NA | 1.06E-08 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | NA | 1.08E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | NA | 8.36E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | NA | 1.48E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | NA | 2.48E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | 5.43E-07 | 9.54E-08 | mr1755 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | NA | 1.31E-07 | mr1755 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | NA | 3.98E-06 | mr1817 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | NA | 2.51E-08 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314274098 | NA | 3.96E-06 | mr1817_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |