\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314274098:

Variant ID: vg0314274098 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14274098
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGGACGCTTCAACCTCAAACAACACGTACTTCTCTCTTACCTCCTACGCAAGATCGAACGGGACACGCTTCCACGTTAAGGCCGGGACACACACCAGC[A/G]
CTAGCAGCAGGTCCGCCGAGCCCGTCCTCCTCCGGTCCTCCCTCCAAGTTGCGGAATTGAGATGCGATGGGCCGGCCGATGGCACAAACGAAACCGCTGC

Reverse complement sequence

GCAGCGGTTTCGTTTGTGCCATCGGCCGGCCCATCGCATCTCAATTCCGCAACTTGGAGGGAGGACCGGAGGAGGACGGGCTCGGCGGACCTGCTGCTAG[T/C]
GCTGGTGTGTGTCCCGGCCTTAACGTGGAAGCGTGTCCCGTTCGATCTTGCGTAGGAGGTAAGAGAGAAGTACGTGTTGTTTGAGGTTGAAGCGTCCTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 17.50% 0.04% 0.00% NA
All Indica  2759 70.40% 29.60% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 71.90% 28.10% 0.00% 0.00% NA
Indica II  465 79.60% 20.40% 0.00% 0.00% NA
Indica III  913 64.60% 35.30% 0.11% 0.00% NA
Indica Intermediate  786 70.40% 29.50% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314274098 A -> G LOC_Os03g25010.1 upstream_gene_variant ; 2377.0bp to feature; MODIFIER silent_mutation Average:76.628; most accessible tissue: Callus, score: 84.679 N N N N
vg0314274098 A -> G LOC_Os03g25000.1 downstream_gene_variant ; 2161.0bp to feature; MODIFIER silent_mutation Average:76.628; most accessible tissue: Callus, score: 84.679 N N N N
vg0314274098 A -> G LOC_Os03g25000-LOC_Os03g25010 intergenic_region ; MODIFIER silent_mutation Average:76.628; most accessible tissue: Callus, score: 84.679 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314274098 NA 5.41E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314274098 NA 5.27E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 NA 1.06E-08 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 NA 1.08E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 NA 8.36E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 NA 1.48E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 NA 2.48E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 5.43E-07 9.54E-08 mr1755 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 NA 1.31E-07 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 NA 3.98E-06 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 NA 2.51E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314274098 NA 3.96E-06 mr1817_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251