\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314262681:

Variant ID: vg0314262681 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14262681
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTCGAACAGTGCCCATGGGTCCCACACAGGCTGTCGAAAAGAATTTCTGATGTGGGTCCCACATAATTACCACACACAAAAAAAAGCCCAAAAGCC[C/T]
AGACACAAATAAAAAGCTCATAAGCCCACACACCGACACTACAAAATGAACTACAAGCCAGTACGAATCACAAAGAAATCCGACGGCTTAAAAAACGAAT

Reverse complement sequence

ATTCGTTTTTTAAGCCGTCGGATTTCTTTGTGATTCGTACTGGCTTGTAGTTCATTTTGTAGTGTCGGTGTGTGGGCTTATGAGCTTTTTATTTGTGTCT[G/A]
GGCTTTTGGGCTTTTTTTTGTGTGTGGTAATTATGTGGGACCCACATCAGAAATTCTTTTCGACAGCCTGTGTGGGACCCATGGGCACTGTTCGAATTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.30% 18.80% 32.12% 5.80% NA
All Indica  2759 11.30% 31.50% 50.27% 6.92% NA
All Japonica  1512 99.50% 0.00% 0.40% 0.13% NA
Aus  269 33.80% 4.80% 35.69% 25.65% NA
Indica I  595 2.00% 36.80% 52.10% 9.08% NA
Indica II  465 6.50% 41.90% 45.59% 6.02% NA
Indica III  913 20.70% 24.20% 49.40% 5.70% NA
Indica Intermediate  786 10.30% 29.80% 52.67% 7.25% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.20% 0.00% 0.60% 0.20% NA
Japonica Intermediate  241 98.80% 0.00% 0.83% 0.41% NA
VI/Aromatic  96 90.60% 1.00% 6.25% 2.08% NA
Intermediate  90 57.80% 5.60% 25.56% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314262681 C -> T LOC_Os03g24990.1 upstream_gene_variant ; 81.0bp to feature; MODIFIER silent_mutation Average:19.896; most accessible tissue: Callus, score: 46.571 N N N N
vg0314262681 C -> T LOC_Os03g24980.1 downstream_gene_variant ; 4152.0bp to feature; MODIFIER silent_mutation Average:19.896; most accessible tissue: Callus, score: 46.571 N N N N
vg0314262681 C -> T LOC_Os03g24990-LOC_Os03g25000 intergenic_region ; MODIFIER silent_mutation Average:19.896; most accessible tissue: Callus, score: 46.571 N N N N
vg0314262681 C -> DEL N N silent_mutation Average:19.896; most accessible tissue: Callus, score: 46.571 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314262681 NA 1.29E-37 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681 NA 1.35E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681 NA 9.27E-41 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681 NA 3.91E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681 NA 1.27E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681 1.95E-06 1.95E-06 mr1978 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681 NA 2.93E-57 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681 NA 7.17E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251