Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314262681:

Variant ID: vg0314262681 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14262681
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATTCGAACAGTGCCCATGGGTCCCACACAGGCTGTCGAAAAGAATTTCTGATGTGGGTCCCACATAATTACCACACACAAAAAAAAGCCCAAAAGCC[C/T]
AGACACAAATAAAAAGCTCATAAGCCCACACACCGACACTACAAAATGAACTACAAGCCAGTACGAATCACAAAGAAATCCGACGGCTTAAAAAACGAAT

Reverse complement sequence

ATTCGTTTTTTAAGCCGTCGGATTTCTTTGTGATTCGTACTGGCTTGTAGTTCATTTTGTAGTGTCGGTGTGTGGGCTTATGAGCTTTTTATTTGTGTCT[G/A]
GGCTTTTGGGCTTTTTTTTGTGTGTGGTAATTATGTGGGACCCACATCAGAAATTCTTTTCGACAGCCTGTGTGGGACCCATGGGCACTGTTCGAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.30%	18.80%	32.12%	5.80%	NA
All Indica	2759	11.30%	31.50%	50.27%	6.92%	NA
All Japonica	1512	99.50%	0.00%	0.40%	0.13%	NA
Aus	269	33.80%	4.80%	35.69%	25.65%	NA
Indica I	595	2.00%	36.80%	52.10%	9.08%	NA
Indica II	465	6.50%	41.90%	45.59%	6.02%	NA
Indica III	913	20.70%	24.20%	49.40%	5.70%	NA
Indica Intermediate	786	10.30%	29.80%	52.67%	7.25%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.60%	0.20%	NA
Japonica Intermediate	241	98.80%	0.00%	0.83%	0.41%	NA
VI/Aromatic	96	90.60%	1.00%	6.25%	2.08%	NA
Intermediate	90	57.80%	5.60%	25.56%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314262681	C -> T	LOC_Os03g24990.1	upstream_gene_variant ; 81.0bp to feature; MODIFIER	silent_mutation	Average:19.896; most accessible tissue: Callus, score: 46.571	N	N	N	N
vg0314262681	C -> T	LOC_Os03g24980.1	downstream_gene_variant ; 4152.0bp to feature; MODIFIER	silent_mutation	Average:19.896; most accessible tissue: Callus, score: 46.571	N	N	N	N
vg0314262681	C -> T	LOC_Os03g24990-LOC_Os03g25000	intergenic_region ; MODIFIER	silent_mutation	Average:19.896; most accessible tissue: Callus, score: 46.571	N	N	N	N
vg0314262681	C -> DEL	N	N	silent_mutation	Average:19.896; most accessible tissue: Callus, score: 46.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314262681	NA	1.29E-37	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681	NA	1.35E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681	NA	9.27E-41	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681	NA	3.91E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681	NA	1.27E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681	1.95E-06	1.95E-06	mr1978	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681	NA	2.93E-57	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314262681	NA	7.17E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251