\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314222238:

Variant ID: vg0314222238 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14222238
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAAATAAAGTGGAGAGTAATTGTATTGGGATTTGATAAAGTAGGAATATTCATAGTTTTATTGATATGTGTGAAATGGGTAAAAAAGAACTTACTCTC[T/C]
CCGTCCCAAAATATAGCATTCTAGCATCGGACGTGACATATCATATTTCTACGAATCTGAAGAGAAGGATATGTCCAATTCAATCCTAGATTCCTATATT

Reverse complement sequence

AATATAGGAATCTAGGATTGAATTGGACATATCCTTCTCTTCAGATTCGTAGAAATATGATATGTCACGTCCGATGCTAGAATGCTATATTTTGGGACGG[A/G]
GAGAGTAAGTTCTTTTTTACCCATTTCACACATATCAATAAAACTATGAATATTCCTACTTTATCAAATCCCAATACAATTACTCTCCACTTTATTTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 34.90% 0.55% 16.65% NA
All Indica  2759 69.70% 1.30% 0.87% 28.16% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 97.80% 0.70% 0.37% 1.12% NA
Indica I  595 70.60% 0.30% 0.17% 28.91% NA
Indica II  465 84.10% 0.00% 0.22% 15.70% NA
Indica III  913 59.60% 2.50% 1.20% 36.69% NA
Indica Intermediate  786 72.30% 1.30% 1.40% 25.06% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 41.10% 50.00% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314222238 T -> C LOC_Os03g24940.1 upstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:33.796; most accessible tissue: Callus, score: 72.04 N N N N
vg0314222238 T -> C LOC_Os03g24940.2 upstream_gene_variant ; 1624.0bp to feature; MODIFIER silent_mutation Average:33.796; most accessible tissue: Callus, score: 72.04 N N N N
vg0314222238 T -> C LOC_Os03g24940-LOC_Os03g24950 intergenic_region ; MODIFIER silent_mutation Average:33.796; most accessible tissue: Callus, score: 72.04 N N N N
vg0314222238 T -> DEL N N silent_mutation Average:33.796; most accessible tissue: Callus, score: 72.04 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314222238 NA 1.00E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314222238 NA 3.60E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 2.86E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 4.86E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 9.71E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 2.07E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 6.09E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 7.85E-08 mr1227 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 1.67E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 6.38E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 1.14E-06 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 1.45E-07 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 5.30E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238 NA 3.86E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251