Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314222238:

Variant ID: vg0314222238 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14222238
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGAAATAAAGTGGAGAGTAATTGTATTGGGATTTGATAAAGTAGGAATATTCATAGTTTTATTGATATGTGTGAAATGGGTAAAAAAGAACTTACTCTC[T/C]
CCGTCCCAAAATATAGCATTCTAGCATCGGACGTGACATATCATATTTCTACGAATCTGAAGAGAAGGATATGTCCAATTCAATCCTAGATTCCTATATT

Reverse complement sequence

AATATAGGAATCTAGGATTGAATTGGACATATCCTTCTCTTCAGATTCGTAGAAATATGATATGTCACGTCCGATGCTAGAATGCTATATTTTGGGACGG[A/G]
GAGAGTAAGTTCTTTTTTACCCATTTCACACATATCAATAAAACTATGAATATTCCTACTTTATCAAATCCCAATACAATTACTCTCCACTTTATTTCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.90%	34.90%	0.55%	16.65%	NA
All Indica	2759	69.70%	1.30%	0.87%	28.16%	NA
All Japonica	1512	1.30%	98.70%	0.00%	0.00%	NA
Aus	269	97.80%	0.70%	0.37%	1.12%	NA
Indica I	595	70.60%	0.30%	0.17%	28.91%	NA
Indica II	465	84.10%	0.00%	0.22%	15.70%	NA
Indica III	913	59.60%	2.50%	1.20%	36.69%	NA
Indica Intermediate	786	72.30%	1.30%	1.40%	25.06%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	2.80%	97.20%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	41.10%	50.00%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314222238	T -> C	LOC_Os03g24940.1	upstream_gene_variant ; 1555.0bp to feature; MODIFIER	silent_mutation	Average:33.796; most accessible tissue: Callus, score: 72.04	N	N	N	N
vg0314222238	T -> C	LOC_Os03g24940.2	upstream_gene_variant ; 1624.0bp to feature; MODIFIER	silent_mutation	Average:33.796; most accessible tissue: Callus, score: 72.04	N	N	N	N
vg0314222238	T -> C	LOC_Os03g24940-LOC_Os03g24950	intergenic_region ; MODIFIER	silent_mutation	Average:33.796; most accessible tissue: Callus, score: 72.04	N	N	N	N
vg0314222238	T -> DEL	N	N	silent_mutation	Average:33.796; most accessible tissue: Callus, score: 72.04	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314222238	NA	1.00E-14	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314222238	NA	3.60E-07	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	2.86E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	4.86E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	9.71E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	2.07E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	6.09E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	7.85E-08	mr1227	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	1.67E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	6.38E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	1.14E-06	mr1817	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	1.45E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	5.30E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314222238	NA	3.86E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251