\
| Variant ID: vg0314131280 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14131280 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCATAAAGAGGCATGGGGACGTCGCTTGCCGTTGTCAGGCCGCTGATCATTAATTGGCCGACGCGGCGCTCCACGGTGGCGTCACTCAAGCCTGCAGATC[A/G]
AGAACAGAATTCGATAAATTAGGGAGAACATGCACAGAAGGGGATCAAATTAAACACAAGAAAAATACCCCGAGGAGAAACCCGGGTCGCGTCCTCCGGC
GCCGGAGGACGCGACCCGGGTTTCTCCTCGGGGTATTTTTCTTGTGTTTAATTTGATCCCCTTCTGTGCATGTTCTCCCTAATTTATCGAATTCTGTTCT[T/C]
GATCTGCAGGCTTGAGTGACGCCACCGTGGAGCGCCGCGTCGGCCAATTAATGATCAGCGGCCTGACAACGGCAAGCGACGTCCCCATGCCTCTTTATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.10% | 28.40% | 9.01% | 27.51% | NA |
| All Indica | 2759 | 4.30% | 47.30% | 8.30% | 40.05% | NA |
| All Japonica | 1512 | 93.50% | 0.20% | 0.73% | 5.56% | NA |
| Aus | 269 | 5.20% | 4.10% | 59.11% | 31.60% | NA |
| Indica I | 595 | 7.60% | 22.00% | 4.03% | 66.39% | NA |
| Indica II | 465 | 4.90% | 28.80% | 10.54% | 55.70% | NA |
| Indica III | 913 | 0.80% | 79.80% | 8.54% | 10.84% | NA |
| Indica Intermediate | 786 | 5.60% | 39.70% | 9.92% | 44.78% | NA |
| Temperate Japonica | 767 | 91.50% | 0.10% | 0.13% | 8.21% | NA |
| Tropical Japonica | 504 | 95.20% | 0.20% | 1.39% | 3.17% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.40% | 1.24% | 2.07% | NA |
| VI/Aromatic | 96 | 72.90% | 1.00% | 18.75% | 7.29% | NA |
| Intermediate | 90 | 46.70% | 22.20% | 10.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314131280 | A -> DEL | N | N | silent_mutation | Average:11.573; most accessible tissue: Callus, score: 43.229 | N | N | N | N |
| vg0314131280 | A -> G | LOC_Os03g24790.1 | downstream_gene_variant ; 2976.0bp to feature; MODIFIER | silent_mutation | Average:11.573; most accessible tissue: Callus, score: 43.229 | N | N | N | N |
| vg0314131280 | A -> G | LOC_Os03g24800.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.573; most accessible tissue: Callus, score: 43.229 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314131280 | NA | 8.61E-11 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314131280 | NA | 1.64E-08 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 1.66E-12 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 4.40E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 9.06E-09 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 4.87E-09 | mr1532 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 4.32E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 4.42E-12 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 1.30E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 1.29E-21 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 9.43E-09 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 3.91E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 5.50E-17 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 8.31E-08 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 1.27E-09 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 1.04E-06 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 9.54E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 1.71E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 2.91E-10 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 3.82E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 4.63E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 2.63E-09 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 1.68E-07 | mr1882_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314131280 | NA | 8.21E-11 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |