Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314131183:

Variant ID: vg0314131183 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14131183
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACCGCATGAAATCATTTTCCGACCCGGGAAGCAAAAATAGTGAGGTTACCGAGTACACTCACGTTGATTGCGGCTTCACGCTCGATCGCCTCCTTATCA[T/C]
AAAGAGGCATGGGGACGTCGCTTGCCGTTGTCAGGCCGCTGATCATTAATTGGCCGACGCGGCGCTCCACGGTGGCGTCACTCAAGCCTGCAGATCAAGA

Reverse complement sequence

TCTTGATCTGCAGGCTTGAGTGACGCCACCGTGGAGCGCCGCGTCGGCCAATTAATGATCAGCGGCCTGACAACGGCAAGCGACGTCCCCATGCCTCTTT[A/G]
TGATAAGGAGGCGATCGAGCGTGAAGCCGCAATCAACGTGAGTGTACTCGGTAACCTCACTATTTTTGCTTCCCGGGTCGGAAAATGATTTCATGCGGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.50%	0.20%	2.45%	62.78%	NA
All Indica	2759	3.80%	0.20%	2.97%	93.08%	NA
All Japonica	1512	93.10%	0.00%	0.33%	6.61%	NA
Aus	269	3.30%	0.70%	8.18%	87.73%	NA
Indica I	595	5.50%	0.00%	0.67%	93.78%	NA
Indica II	465	3.20%	0.20%	0.22%	96.34%	NA
Indica III	913	1.60%	0.20%	5.48%	92.66%	NA
Indica Intermediate	786	5.20%	0.30%	3.44%	91.09%	NA
Temperate Japonica	767	91.00%	0.00%	0.26%	8.74%	NA
Tropical Japonica	504	94.60%	0.00%	0.60%	4.76%	NA
Japonica Intermediate	241	96.30%	0.00%	0.00%	3.73%	NA
VI/Aromatic	96	72.90%	0.00%	3.12%	23.96%	NA
Intermediate	90	46.70%	4.40%	4.44%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314131183	T -> C	LOC_Os03g24800.1	missense_variant ; p.Tyr151Cys; MODERATE	nonsynonymous_codon ; Y151C	Average:10.491; most accessible tissue: Callus, score: 43.229	benign	-0.438	TOLERATED	1.00
vg0314131183	T -> DEL	LOC_Os03g24800.1	N	frameshift_variant	Average:10.491; most accessible tissue: Callus, score: 43.229	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314131183	NA	3.67E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314131183	NA	1.36E-08	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	3.31E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	3.47E-22	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	1.12E-08	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	1.83E-12	mr1322	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	6.48E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	1.28E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	2.04E-08	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	1.76E-08	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	2.25E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	2.50E-12	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	2.81E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	2.64E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	6.91E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	6.93E-22	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	1.63E-11	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	9.27E-08	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	4.70E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	3.71E-18	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	1.48E-07	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	2.38E-10	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	8.41E-07	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	9.16E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	3.71E-09	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	4.74E-09	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	5.14E-07	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183	NA	1.38E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251