\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314131183:

Variant ID: vg0314131183 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14131183
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCGCATGAAATCATTTTCCGACCCGGGAAGCAAAAATAGTGAGGTTACCGAGTACACTCACGTTGATTGCGGCTTCACGCTCGATCGCCTCCTTATCA[T/C]
AAAGAGGCATGGGGACGTCGCTTGCCGTTGTCAGGCCGCTGATCATTAATTGGCCGACGCGGCGCTCCACGGTGGCGTCACTCAAGCCTGCAGATCAAGA

Reverse complement sequence

TCTTGATCTGCAGGCTTGAGTGACGCCACCGTGGAGCGCCGCGTCGGCCAATTAATGATCAGCGGCCTGACAACGGCAAGCGACGTCCCCATGCCTCTTT[A/G]
TGATAAGGAGGCGATCGAGCGTGAAGCCGCAATCAACGTGAGTGTACTCGGTAACCTCACTATTTTTGCTTCCCGGGTCGGAAAATGATTTCATGCGGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.50% 0.20% 2.45% 62.78% NA
All Indica  2759 3.80% 0.20% 2.97% 93.08% NA
All Japonica  1512 93.10% 0.00% 0.33% 6.61% NA
Aus  269 3.30% 0.70% 8.18% 87.73% NA
Indica I  595 5.50% 0.00% 0.67% 93.78% NA
Indica II  465 3.20% 0.20% 0.22% 96.34% NA
Indica III  913 1.60% 0.20% 5.48% 92.66% NA
Indica Intermediate  786 5.20% 0.30% 3.44% 91.09% NA
Temperate Japonica  767 91.00% 0.00% 0.26% 8.74% NA
Tropical Japonica  504 94.60% 0.00% 0.60% 4.76% NA
Japonica Intermediate  241 96.30% 0.00% 0.00% 3.73% NA
VI/Aromatic  96 72.90% 0.00% 3.12% 23.96% NA
Intermediate  90 46.70% 4.40% 4.44% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314131183 T -> C LOC_Os03g24800.1 missense_variant ; p.Tyr151Cys; MODERATE nonsynonymous_codon ; Y151C Average:10.491; most accessible tissue: Callus, score: 43.229 benign -0.438 TOLERATED 1.00
vg0314131183 T -> DEL LOC_Os03g24800.1 N frameshift_variant Average:10.491; most accessible tissue: Callus, score: 43.229 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314131183 NA 3.67E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314131183 NA 1.36E-08 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 3.31E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 3.47E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 1.12E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 1.83E-12 mr1322 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 6.48E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 1.28E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 2.04E-08 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 1.76E-08 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 2.25E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 2.50E-12 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 2.81E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 2.64E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 6.91E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 6.93E-22 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 1.63E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 9.27E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 4.70E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 3.71E-18 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 1.48E-07 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 2.38E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 8.41E-07 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 9.16E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 3.71E-09 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 4.74E-09 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 5.14E-07 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131183 NA 1.38E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251