\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314131167:

Variant ID: vg0314131167 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14131167
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGAGGGAGAGCCTACACCGCATGAAATCATTTTCCGACCCGGGAAGCAAAAATAGTGAGGTTACCGAGTACACTCACGTTGATTGCGGCTTCACGCTC[G/A]
ATCGCCTCCTTATCATAAAGAGGCATGGGGACGTCGCTTGCCGTTGTCAGGCCGCTGATCATTAATTGGCCGACGCGGCGCTCCACGGTGGCGTCACTCA

Reverse complement sequence

TGAGTGACGCCACCGTGGAGCGCCGCGTCGGCCAATTAATGATCAGCGGCCTGACAACGGCAAGCGACGTCCCCATGCCTCTTTATGATAAGGAGGCGAT[C/T]
GAGCGTGAAGCCGCAATCAACGTGAGTGTACTCGGTAACCTCACTATTTTTGCTTCCCGGGTCGGAAAATGATTTCATGCGGTGTAGGCTCTCCCTCTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.40% 11.70% 10.47% 56.37% NA
All Indica  2759 2.10% 0.30% 10.80% 86.77% NA
All Japonica  1512 59.70% 30.80% 3.51% 5.95% NA
Aus  269 6.30% 0.70% 45.35% 47.58% NA
Indica I  595 2.00% 0.20% 11.43% 86.39% NA
Indica II  465 1.30% 0.20% 12.26% 86.24% NA
Indica III  913 1.30% 0.40% 9.86% 88.39% NA
Indica Intermediate  786 3.60% 0.40% 10.56% 85.50% NA
Temperate Japonica  767 86.30% 2.60% 2.61% 8.47% NA
Tropical Japonica  504 15.50% 77.20% 3.57% 3.77% NA
Japonica Intermediate  241 67.60% 23.70% 6.22% 2.49% NA
VI/Aromatic  96 10.40% 63.50% 9.38% 16.67% NA
Intermediate  90 27.80% 17.80% 14.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314131167 G -> A LOC_Os03g24800.1 synonymous_variant ; p.Ile156Ile; LOW synonymous_codon Average:8.883; most accessible tissue: Callus, score: 25.538 N N N N
vg0314131167 G -> A LOC_Os03g24800.1 synonymous_variant ; p.Ile156Ile; LOW nonsynonymous_codon ; I156T Average:8.883; most accessible tissue: Callus, score: 25.538 benign -1.336 TOLERATED 0.19
vg0314131167 G -> DEL LOC_Os03g24800.1 N frameshift_variant Average:8.883; most accessible tissue: Callus, score: 25.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314131167 NA 8.52E-10 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 5.49E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 7.63E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 1.23E-10 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 1.14E-11 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 1.64E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 4.78E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 2.55E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 1.12E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 5.17E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 1.04E-08 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 9.85E-16 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 2.11E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 6.17E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 6.63E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 3.91E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 2.63E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 1.51E-11 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 3.96E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 8.17E-09 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 3.81E-12 mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 5.56E-15 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 5.34E-09 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 6.33E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 2.13E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 5.67E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 5.56E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 5.10E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 1.35E-13 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 1.11E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 2.61E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 4.24E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 2.21E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 2.33E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314131167 NA 1.12E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251