\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314130207:

Variant ID: vg0314130207 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14130207
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGAGGGTATCGCCTCCATCGCCGTAGCCAGTTCCGCAAGTGAGGACGTCAGCGAGAACTCGTCGGGGTTCGCTGGGATGGTTGTCGTGACGCCACACT[G/C]
CCCGGCGAGCTGATGAAGACCGGTGTAGGTGACCCGCAGCGACCCACGGATCTCCGACAGGTTGTTCTCGAGTTCCGACATCCGGTCCTCGAGTCCCCGC

Reverse complement sequence

GCGGGGACTCGAGGACCGGATGTCGGAACTCGAGAACAACCTGTCGGAGATCCGTGGGTCGCTGCGGGTCACCTACACCGGTCTTCATCAGCTCGCCGGG[C/G]
AGTGTGGCGTCACGACAACCATCCCAGCGAACCCCGACGAGTTCTCGCTGACGTCCTCACTTGCGGAACTGGCTACGGCGATGGAGGCGATACCCTCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 34.40% 7.34% 4.38% NA
All Indica  2759 80.10% 3.40% 11.85% 4.68% NA
All Japonica  1512 1.10% 93.40% 0.86% 4.70% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 58.30% 5.90% 28.74% 7.06% NA
Indica II  465 71.40% 4.10% 11.83% 12.69% NA
Indica III  913 96.60% 0.40% 2.08% 0.88% NA
Indica Intermediate  786 82.40% 4.60% 10.43% 2.54% NA
Temperate Japonica  767 0.10% 91.30% 0.26% 8.34% NA
Tropical Japonica  504 2.20% 95.20% 2.18% 0.40% NA
Japonica Intermediate  241 1.70% 96.30% 0.00% 2.07% NA
VI/Aromatic  96 27.10% 71.90% 1.04% 0.00% NA
Intermediate  90 40.00% 46.70% 5.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314130207 G -> C LOC_Os03g24800.1 missense_variant ; p.Gln373Glu; MODERATE nonsynonymous_codon ; Q373E Average:14.445; most accessible tissue: Callus, score: 38.058 probably damaging -2.04 TOLERATED 1.00
vg0314130207 G -> DEL LOC_Os03g24800.1 N frameshift_variant Average:14.445; most accessible tissue: Callus, score: 38.058 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314130207 NA 4.20E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 5.36E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 3.01E-11 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 1.27E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 3.34E-08 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 8.87E-12 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 2.12E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 8.62E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 7.28E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 2.89E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 8.89E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 7.73E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 6.52E-19 mr1162_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 2.81E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 7.60E-07 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 1.15E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 3.36E-09 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 1.06E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 3.94E-09 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314130207 NA 6.89E-12 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251