\
| Variant ID: vg0314127667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14127667 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.58, C: 0.42, others allele: 0.00, population size: 72. )
CCGTTCTCGTGCTGGGGGCTATATATACTCGGGCCATTCCCACAAGGACAGGGCGGCTACAAGTTCCTATTCGTGGCGATCGACAAATTCACTAAATGGA[C/T]
CGAAGCGGTACCCACGGGGGAAATCAAGGCCGCCAACGCCATCAAGTTCATCAAGGGGATATTTTGCAGATACGGACTACCGCATCGCATCATTACAGAC
GTCTGTAATGATGCGATGCGGTAGTCCGTATCTGCAAAATATCCCCTTGATGAACTTGATGGCGTTGGCGGCCTTGATTTCCCCCGTGGGTACCGCTTCG[G/A]
TCCATTTAGTGAATTTGTCGATCGCCACGAATAGGAACTTGTAGCCGCCCTGTCCTTGTGGGAATGGCCCGAGTATATATAGCCCCCAGCACGAGAACGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.80% | 34.70% | 9.48% | 14.07% | NA |
| All Indica | 2759 | 59.90% | 3.80% | 15.73% | 20.55% | NA |
| All Japonica | 1512 | 0.80% | 93.50% | 0.13% | 5.62% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 28.90% | 7.20% | 19.33% | 44.54% | NA |
| Indica II | 465 | 46.90% | 4.30% | 20.86% | 27.96% | NA |
| Indica III | 913 | 90.40% | 0.40% | 5.48% | 3.72% | NA |
| Indica Intermediate | 786 | 55.70% | 4.80% | 21.88% | 17.56% | NA |
| Temperate Japonica | 767 | 0.10% | 91.40% | 0.00% | 8.47% | NA |
| Tropical Japonica | 504 | 1.40% | 95.20% | 0.40% | 2.98% | NA |
| Japonica Intermediate | 241 | 1.70% | 96.30% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 22.90% | 74.00% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 31.10% | 44.40% | 11.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314127667 | C -> T | LOC_Os03g24790.1 | missense_variant ; p.Thr311Ile; MODERATE | nonsynonymous_codon ; T311I | Average:12.874; most accessible tissue: Minghui63 young leaf, score: 21.268 | benign |
-0.54 |
TOLERATED | 1.00 |
| vg0314127667 | C -> DEL | LOC_Os03g24790.1 | N | frameshift_variant | Average:12.874; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314127667 | NA | 3.63E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 2.00E-18 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 6.08E-13 | mr1322 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 8.46E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 5.37E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 7.48E-09 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 2.18E-08 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 9.52E-12 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 6.36E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 4.56E-12 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 5.41E-11 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 1.24E-06 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 9.86E-21 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 1.96E-14 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314127667 | NA | 2.60E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |