Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314122304:

Variant ID: vg0314122304 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14122304
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

ACATCGTCAACACCAACCTCAACTACGGGCTTCCTGCCTCAACGATGCTAGCGTGGACTCAAGTCGGCGAAATCGTCTTTCCGGTTTACACCACGATGCC[G/A]
ATCTCAGCTGGGCCATCGATGACCAGAAACGAGAACGCAGTGGCTGTAACCCAAGACGGCTCCACGTCGAAAGGTCCTCCCGCCGAAGTGGAGAAAGGAA

Reverse complement sequence

TTCCTTTCTCCACTTCGGCGGGAGGACCTTTCGACGTGGAGCCGTCTTGGGTTACAGCCACTGCGTTCTCGTTTCTGGTCATCGATGGCCCAGCTGAGAT[C/T]
GGCATCGTGGTGTAAACCGGAAAGACGATTTCGCCGACTTGAGTCCACGCTAGCATCGTTGAGGCAGGAAGCCCGTAGTTGAGGTTGGTGTTGACGATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	14.80%	2.67%	9.94%	NA
All Indica	2759	81.60%	1.10%	3.59%	13.70%	NA
All Japonica	1512	61.50%	37.80%	0.46%	0.20%	NA
Aus	269	62.50%	1.90%	5.58%	30.11%	NA
Indica I	595	52.60%	2.70%	6.72%	37.98%	NA
Indica II	465	80.00%	0.90%	3.01%	16.13%	NA
Indica III	913	97.90%	0.20%	1.10%	0.77%	NA
Indica Intermediate	786	85.60%	1.00%	4.45%	8.91%	NA
Temperate Japonica	767	96.30%	3.30%	0.26%	0.13%	NA
Tropical Japonica	504	16.30%	83.10%	0.40%	0.20%	NA
Japonica Intermediate	241	45.20%	53.10%	1.24%	0.41%	NA
VI/Aromatic	96	25.00%	71.90%	3.12%	0.00%	NA
Intermediate	90	61.10%	27.80%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314122304	G -> A	LOC_Os03g24780.1	upstream_gene_variant ; 989.0bp to feature; MODIFIER	silent_mutation	Average:10.036; most accessible tissue: Callus, score: 28.304	N	N	N	N
vg0314122304	G -> A	LOC_Os03g24790.1	upstream_gene_variant ; 4360.0bp to feature; MODIFIER	silent_mutation	Average:10.036; most accessible tissue: Callus, score: 28.304	N	N	N	N
vg0314122304	G -> A	LOC_Os03g24770.1	downstream_gene_variant ; 1959.0bp to feature; MODIFIER	silent_mutation	Average:10.036; most accessible tissue: Callus, score: 28.304	N	N	N	N
vg0314122304	G -> A	LOC_Os03g24770-LOC_Os03g24780	intergenic_region ; MODIFIER	silent_mutation	Average:10.036; most accessible tissue: Callus, score: 28.304	N	N	N	N
vg0314122304	G -> DEL	N	N	silent_mutation	Average:10.036; most accessible tissue: Callus, score: 28.304	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314122304	NA	9.99E-14	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	3.32E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	4.16E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	7.23E-12	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	4.97E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	8.58E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	3.09E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	4.90E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	7.93E-09	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	1.06E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	2.49E-11	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	2.00E-12	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	6.36E-10	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	1.20E-09	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	1.86E-09	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	4.15E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	3.16E-15	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	7.07E-10	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	1.79E-09	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	7.30E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	9.73E-17	mr1578_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	4.37E-09	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	2.59E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	2.44E-11	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	7.89E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	2.69E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	8.12E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	5.77E-10	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	5.05E-06	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	1.04E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	1.89E-07	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	2.58E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	4.36E-14	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	1.03E-09	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	5.55E-08	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	3.03E-11	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	1.78E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	2.05E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314122304	NA	1.07E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251