| Variant ID: vg0314107109 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 14107109 |
| Reference Allele: T | Alternative Allele: C,TC,TCTC |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACCCAGGATTATGTGACACTTACCAAAATTCATGTGGTTCATGAAACTTAGACCATAGGTGAGGTTCAATAAACTTTACTCTCTCTCTCTCTCTCTCTCT[T/C,TC,TCTC]
TTAATCTCAGCTGACTCATACGCTGTCGGATTCATGGACAGTGCACTACATACAGGGAGTCATAGAAGGTATAGTAGAGATACTGGTGGATTTGCTCCAT
ATGGAGCAAATCCACCAGTATCTCTACTATACCTTCTATGACTCCCTGTATGTAGTGCACTGTCCATGAATCCGACAGCGTATGAGTCAGCTGAGATTAA[A/G,GA,GAGA]
AGAGAGAGAGAGAGAGAGAGAGTAAAGTTTATTGAACCTCACCTATGGTCTAAGTTTCATGAACCACATGAATTTTGGTAAGTGTCACATAATCCTGGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.40% | 4.50% | 3.24% | 60.45% | TC: 0.34%; TCTC: 0.02% |
| All Indica | 2759 | 4.60% | 0.00% | 2.72% | 92.61% | NA |
| All Japonica | 1512 | 75.90% | 13.80% | 4.17% | 5.36% | TC: 0.79% |
| Aus | 269 | 31.60% | 0.00% | 3.35% | 63.20% | TC: 1.49%; TCTC: 0.37% |
| Indica I | 595 | 2.70% | 0.00% | 4.71% | 92.61% | NA |
| Indica II | 465 | 1.10% | 0.00% | 2.37% | 96.56% | NA |
| Indica III | 913 | 6.00% | 0.10% | 1.53% | 92.33% | NA |
| Indica Intermediate | 786 | 6.60% | 0.00% | 2.80% | 90.59% | NA |
| Temperate Japonica | 767 | 87.20% | 1.70% | 2.22% | 8.87% | NA |
| Tropical Japonica | 504 | 56.50% | 31.90% | 7.94% | 1.59% | TC: 1.98% |
| Japonica Intermediate | 241 | 80.10% | 14.50% | 2.49% | 2.07% | TC: 0.83% |
| VI/Aromatic | 96 | 85.40% | 1.00% | 2.08% | 11.46% | NA |
| Intermediate | 90 | 46.70% | 4.40% | 4.44% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314107109 | T -> C | LOC_Os03g24750.1 | downstream_gene_variant ; 4530.0bp to feature; MODIFIER | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| vg0314107109 | T -> C | LOC_Os03g24760.1 | downstream_gene_variant ; 91.0bp to feature; MODIFIER | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| vg0314107109 | T -> C | LOC_Os03g24750-LOC_Os03g24760 | intergenic_region ; MODIFIER | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| vg0314107109 | T -> TC | LOC_Os03g24750.1 | downstream_gene_variant ; 4531.0bp to feature; MODIFIER | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| vg0314107109 | T -> TC | LOC_Os03g24760.1 | downstream_gene_variant ; 90.0bp to feature; MODIFIER | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| vg0314107109 | T -> TC | LOC_Os03g24750-LOC_Os03g24760 | intergenic_region ; MODIFIER | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| vg0314107109 | T -> DEL | N | N | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| vg0314107109 | T -> TCTC | LOC_Os03g24750.1 | downstream_gene_variant ; 4531.0bp to feature; MODIFIER | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| vg0314107109 | T -> TCTC | LOC_Os03g24760.1 | downstream_gene_variant ; 90.0bp to feature; MODIFIER | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| vg0314107109 | T -> TCTC | LOC_Os03g24750-LOC_Os03g24760 | intergenic_region ; MODIFIER | silent_mutation | Average:40.506; most accessible tissue: Minghui63 root, score: 67.73 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314107109 | 8.59E-06 | 1.22E-16 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314107109 | 2.60E-07 | 5.83E-16 | mr1410 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314107109 | NA | 7.99E-08 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314107109 | 3.09E-06 | 1.46E-17 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314107109 | NA | 7.70E-14 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |