\
| Variant ID: vg0313995582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13995582 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACCTATTATTTTTTATTAGGACGGATGAAAAATTTTCACCTCTTCTTTTGCAAAAAGAAAACAAAATCTGACCTATTGCTATGAATCAATCGCAAAAGTT[C/A]
AAAAAAAAACGATGTTGCTTCTGCTTCACACAGATTTTGCATAAAGCAGTGTTACAAAGCTTATGGAAATATACTACCTTCTTTTCTAATATATGACGTT
AACGTCATATATTAGAAAAGAAGGTAGTATATTTCCATAAGCTTTGTAACACTGCTTTATGCAAAATCTGTGTGAAGCAGAAGCAACATCGTTTTTTTTT[G/T]
AACTTTTGCGATTGATTCATAGCAATAGGTCAGATTTTGTTTTCTTTTTGCAAAAGAAGAGGTGAAAATTTTTCATCCGTCCTAATAAAAAATAATAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 30.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 13.10% | 86.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 20.90% | 79.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 37.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313995582 | C -> A | LOC_Os03g24550.1 | upstream_gene_variant ; 1801.0bp to feature; MODIFIER | silent_mutation | Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0313995582 | C -> A | LOC_Os03g24560.1 | downstream_gene_variant ; 228.0bp to feature; MODIFIER | silent_mutation | Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0313995582 | C -> A | LOC_Os03g24580.1 | downstream_gene_variant ; 4901.0bp to feature; MODIFIER | silent_mutation | Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0313995582 | C -> A | LOC_Os03g24580.2 | downstream_gene_variant ; 4901.0bp to feature; MODIFIER | silent_mutation | Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0313995582 | C -> A | LOC_Os03g24550-LOC_Os03g24560 | intergenic_region ; MODIFIER | silent_mutation | Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313995582 | NA | 4.03E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0313995582 | NA | 5.22E-17 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 1.19E-11 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 1.15E-15 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 1.86E-11 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 4.89E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 2.43E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 1.07E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 1.87E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 1.48E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 9.70E-14 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 4.10E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 6.42E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 1.60E-17 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 8.38E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 2.21E-18 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 4.11E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 3.81E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 6.86E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 3.57E-30 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 1.22E-09 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 7.36E-11 | mr1821_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313995582 | NA | 1.28E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |