Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313995582:

Variant ID: vg0313995582 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13995582
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTATTATTTTTTATTAGGACGGATGAAAAATTTTCACCTCTTCTTTTGCAAAAAGAAAACAAAATCTGACCTATTGCTATGAATCAATCGCAAAAGTT[C/A]
AAAAAAAAACGATGTTGCTTCTGCTTCACACAGATTTTGCATAAAGCAGTGTTACAAAGCTTATGGAAATATACTACCTTCTTTTCTAATATATGACGTT

Reverse complement sequence

AACGTCATATATTAGAAAAGAAGGTAGTATATTTCCATAAGCTTTGTAACACTGCTTTATGCAAAATCTGTGTGAAGCAGAAGCAACATCGTTTTTTTTT[G/T]
AACTTTTGCGATTGATTCATAGCAATAGGTCAGATTTTGTTTTCTTTTTGCAAAAGAAGAGGTGAAAATTTTTCATCCGTCCTAATAAAAAATAATAGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 30.20% 0.02% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 13.10% 86.90% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 20.90% 79.10% 0.00% 0.00% NA
Tropical Japonica  504 4.60% 95.40% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313995582 C -> A LOC_Os03g24550.1 upstream_gene_variant ; 1801.0bp to feature; MODIFIER silent_mutation Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0313995582 C -> A LOC_Os03g24560.1 downstream_gene_variant ; 228.0bp to feature; MODIFIER silent_mutation Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0313995582 C -> A LOC_Os03g24580.1 downstream_gene_variant ; 4901.0bp to feature; MODIFIER silent_mutation Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0313995582 C -> A LOC_Os03g24580.2 downstream_gene_variant ; 4901.0bp to feature; MODIFIER silent_mutation Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0313995582 C -> A LOC_Os03g24550-LOC_Os03g24560 intergenic_region ; MODIFIER silent_mutation Average:31.618; most accessible tissue: Minghui63 root, score: 41.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313995582 NA 4.03E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0313995582 NA 5.22E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 1.19E-11 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 1.15E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 1.86E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 4.89E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 2.43E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 1.07E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 1.87E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 1.48E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 9.70E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 4.10E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 6.42E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 1.60E-17 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 8.38E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 2.21E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 4.11E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 3.81E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 6.86E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 3.57E-30 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 1.22E-09 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 7.36E-11 mr1821_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313995582 NA 1.28E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251