\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313992746:

Variant ID: vg0313992746 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13992746
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTTTCTCAACTTTTTTTTGGGAGGGGGAGGGGGTGTTAGCGTTCTCCGTTGTGACGAGATGCATGCGCTCACTGTGGACGCCACTGCACCTGTCGCGCA[T/C]
GCCTTCACATGCGACACGAAACGCTTCCCTACGCCACTGCTAGGCCATGCCACCCCCGCAGCGGCGGTGGCGGAGAAGCCGAACACGACTACGTGGTTGG

Reverse complement sequence

CCAACCACGTAGTCGTGTTCGGCTTCTCCGCCACCGCCGCTGCGGGGGTGGCATGGCCTAGCAGTGGCGTAGGGAAGCGTTTCGTGTCGCATGTGAAGGC[A/G]
TGCGCGACAGGTGCAGTGGCGTCCACAGTGAGCGCATGCATCTCGTCACAACGGAGAACGCTAACACCCCCTCCCCCTCCCAAAAAAAAGTTGAGAAACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 8.20% 0.00% 0.00% NA
All Indica  2759 97.80% 2.20% 0.00% 0.00% NA
All Japonica  1512 88.90% 11.10% 0.00% 0.00% NA
Aus  269 44.60% 55.40% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 80.20% 19.80% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313992746 T -> C LOC_Os03g24540.1 upstream_gene_variant ; 2656.0bp to feature; MODIFIER silent_mutation Average:68.306; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg0313992746 T -> C LOC_Os03g24560.1 downstream_gene_variant ; 3064.0bp to feature; MODIFIER silent_mutation Average:68.306; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg0313992746 T -> C LOC_Os03g24550.1 intron_variant ; MODIFIER silent_mutation Average:68.306; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313992746 NA 6.70E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313992746 NA 9.68E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313992746 NA 3.56E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313992746 NA 1.38E-12 mr1510_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313992746 NA 2.42E-09 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313992746 NA 4.32E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251