\
| Variant ID: vg0313992746 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13992746 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGTTTCTCAACTTTTTTTTGGGAGGGGGAGGGGGTGTTAGCGTTCTCCGTTGTGACGAGATGCATGCGCTCACTGTGGACGCCACTGCACCTGTCGCGCA[T/C]
GCCTTCACATGCGACACGAAACGCTTCCCTACGCCACTGCTAGGCCATGCCACCCCCGCAGCGGCGGTGGCGGAGAAGCCGAACACGACTACGTGGTTGG
CCAACCACGTAGTCGTGTTCGGCTTCTCCGCCACCGCCGCTGCGGGGGTGGCATGGCCTAGCAGTGGCGTAGGGAAGCGTTTCGTGTCGCATGTGAAGGC[A/G]
TGCGCGACAGGTGCAGTGGCGTCCACAGTGAGCGCATGCATCTCGTCACAACGGAGAACGCTAACACCCCCTCCCCCTCCCAAAAAAAAGTTGAGAAACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 44.60% | 55.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313992746 | T -> C | LOC_Os03g24540.1 | upstream_gene_variant ; 2656.0bp to feature; MODIFIER | silent_mutation | Average:68.306; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg0313992746 | T -> C | LOC_Os03g24560.1 | downstream_gene_variant ; 3064.0bp to feature; MODIFIER | silent_mutation | Average:68.306; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg0313992746 | T -> C | LOC_Os03g24550.1 | intron_variant ; MODIFIER | silent_mutation | Average:68.306; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313992746 | NA | 6.70E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313992746 | NA | 9.68E-07 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313992746 | NA | 3.56E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313992746 | NA | 1.38E-12 | mr1510_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313992746 | NA | 2.42E-09 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313992746 | NA | 4.32E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |