\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313966137:

Variant ID: vg0313966137 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13966137
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


GACATATATATAGGGGTGGGACTTTAGTCCCAGTTGGTAGCACCAACCGGGGCTAAAGATCACAAGGATCTTTAGCCCCGGTTGGTATTACCAACCGGGA[C/T]
TAAAGTTACGATTTTTAGTCCCGGTTGGTAATCCCGGGGGGGCCTGACATGCCCTGACAGCATTCGAACCGAGATTAAAGATGATCTTTAGTTGTTACCA

Reverse complement sequence

TGGTAACAACTAAAGATCATCTTTAATCTCGGTTCGAATGCTGTCAGGGCATGTCAGGCCCCCCCGGGATTACCAACCGGGACTAAAAATCGTAACTTTA[G/A]
TCCCGGTTGGTAATACCAACCGGGGCTAAAGATCCTTGTGATCTTTAGCCCCGGTTGGTGCTACCAACTGGGACTAAAGTCCCACCCCTATATATATGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 2.00% 30.41% 10.26% NA
All Indica  2759 29.90% 3.30% 49.58% 17.22% NA
All Japonica  1512 99.50% 0.00% 0.13% 0.33% NA
Aus  269 84.40% 0.40% 14.87% 0.37% NA
Indica I  595 20.70% 2.20% 57.82% 19.33% NA
Indica II  465 35.90% 1.30% 37.20% 25.59% NA
Indica III  913 35.70% 5.50% 50.05% 8.76% NA
Indica Intermediate  786 26.50% 2.90% 50.13% 20.48% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.40% 0.00% 0.40% 0.20% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 94.80% 0.00% 5.21% 0.00% NA
Intermediate  90 71.10% 0.00% 24.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313966137 C -> T LOC_Os03g24490.1 upstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0313966137 C -> T LOC_Os03g24500.1 upstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0313966137 C -> T LOC_Os03g24510.1 upstream_gene_variant ; 3974.0bp to feature; MODIFIER silent_mutation Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0313966137 C -> T LOC_Os03g24490-LOC_Os03g24500 intergenic_region ; MODIFIER silent_mutation Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0313966137 C -> DEL N N silent_mutation Average:21.842; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313966137 NA 9.28E-07 mr1322 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313966137 NA 9.06E-06 mr1326 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313966137 NA 1.02E-06 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313966137 7.12E-06 NA mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313966137 1.49E-06 5.00E-06 mr1879 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251