\
| Variant ID: vg0313902394 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13902394 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )
CCAGGTTTTGAGCAGTTTTCAATCATCTCACCTCTAATTCCTTCAATTTGCAATGGCTCCCCTCGTAATCCCCTCGTTGTCGTCAATTTCGTCCCTGGTA[C/T]
GTTCTCTCCATTTTTTGTTTGTTTGAGTAGCTGTTAAATAACACTCCAATCCAAAGTCTCCAATCATCCTAGAGGATAAGACTTCAAGTCTAATTTTGTT
AACAAAATTAGACTTGAAGTCTTATCCTCTAGGATGATTGGAGACTTTGGATTGGAGTGTTATTTAACAGCTACTCAAACAAACAAAAAATGGAGAGAAC[G/A]
TACCAGGGACGAAATTGACGACAACGAGGGGATTACGAGGGGAGCCATTGCAAATTGAAGGAATTAGAGGTGAGATGATTGAAAACTGCTCAAAACCTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 2.20% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 92.00% | 6.70% | 1.32% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 0.90% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 81.00% | 16.70% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 4.10% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313902394 | C -> T | LOC_Os03g24410.1 | upstream_gene_variant ; 2315.0bp to feature; MODIFIER | silent_mutation | Average:58.881; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0313902394 | C -> T | LOC_Os03g24400-LOC_Os03g24410 | intergenic_region ; MODIFIER | silent_mutation | Average:58.881; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313902394 | NA | 2.38E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 2.25E-11 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 2.03E-07 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 1.08E-07 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 1.97E-08 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 3.52E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | 8.99E-06 | 8.99E-06 | mr1424_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 5.84E-08 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 6.62E-09 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | 2.50E-07 | 2.50E-07 | mr1562_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 2.34E-06 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 3.50E-09 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 5.08E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313902394 | NA | 8.80E-07 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |