\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313808304:

Variant ID: vg0313808304 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13808304
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCGCGATAGCCTCGGTGGACTATGATTCGGTTTTTGTAGTTAACCTTTTGTGTTGAATGTTGATATTCTATATATCATTCGGTGATTATTCTAATTTG[T/A]
GATGGATTAGGATTAAATTTTTGCGTTGGATTTGTAATTGGATTGGGATTAAGTCCTTGGCTCAAAACATGTGCTCAATTCGAGCCGAAGCCGATGCGTC

Reverse complement sequence

GACGCATCGGCTTCGGCTCGAATTGAGCACATGTTTTGAGCCAAGGACTTAATCCCAATCCAATTACAAATCCAACGCAAAAATTTAATCCTAATCCATC[A/T]
CAAATTAGAATAATCACCGAATGATATATAGAATATCAACATTCAACACAAAAGGTTAACTACAAAAACCGAATCATAGTCCACCGAGGCTATCGCGGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.80% 4.20% 0.04% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 95.80% 4.10% 0.07% 0.00% NA
Aus  269 66.20% 33.50% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 96.00% 4.00% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 3.70% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313808304 T -> A LOC_Os03g24260.1 downstream_gene_variant ; 1235.0bp to feature; MODIFIER silent_mutation Average:79.128; most accessible tissue: Minghui63 panicle, score: 93.294 N N N N
vg0313808304 T -> A LOC_Os03g24260-LOC_Os03g24270 intergenic_region ; MODIFIER silent_mutation Average:79.128; most accessible tissue: Minghui63 panicle, score: 93.294 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0313808304 T A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313808304 NA 4.86E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313808304 NA 1.54E-06 mr1219 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313808304 NA 3.94E-06 mr1274 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313808304 NA 5.42E-06 mr1201_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313808304 NA 1.48E-06 mr1219_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313808304 4.93E-07 2.45E-09 mr1274_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251