\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313678497:

Variant ID: vg0313678497 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 13678497
Reference Allele: TAlternative Allele: C,TC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACATAAAAACCACCAACCCACATCTCCTAACTCCCCAATGGAGATTACATTGACCGGTCCAATAATCCAAGCAGCGTAACAGTTTTTCTCTCTCTCTCT[T/C,TC]
TTTTTTTTAAAAAAAAATTCGAGTTGAAAACTTGAAATGGACAGCACGCAGTTCTCATTAAATTTTGCTGTTTCGAACAAAATCGTAATGTAGATAGATC

Reverse complement sequence

GATCTATCTACATTACGATTTTGTTCGAAACAGCAAAATTTAATGAGAACTGCGTGCTGTCCATTTCAAGTTTTCAACTCGAATTTTTTTTTAAAAAAAA[A/G,GA]
AGAGAGAGAGAGAAAAACTGTTACGCTGCTTGGATTATTGGACCGGTCAATGTAATCTCCATTGGGGAGTTAGGAGATGTGGGTTGGTGGTTTTTATGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.70% 38.70% 3.17% 11.28% TC: 0.08%
All Indica  2759 49.40% 32.90% 4.13% 13.45% TC: 0.11%
All Japonica  1512 53.70% 44.20% 1.85% 0.13% TC: 0.07%
Aus  269 0.70% 43.90% 1.12% 54.28% NA
Indica I  595 30.40% 57.00% 1.68% 10.92% NA
Indica II  465 26.70% 17.80% 12.47% 43.01% NA
Indica III  913 71.70% 26.30% 0.77% 0.99% TC: 0.22%
Indica Intermediate  786 51.10% 31.40% 4.96% 12.34% TC: 0.13%
Temperate Japonica  767 93.00% 6.60% 0.39% 0.00% NA
Tropical Japonica  504 9.30% 86.50% 4.17% 0.00% NA
Japonica Intermediate  241 21.60% 75.50% 1.66% 0.83% TC: 0.41%
VI/Aromatic  96 0.00% 95.80% 2.08% 2.08% NA
Intermediate  90 36.70% 46.70% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313678497 T -> C LOC_Os03g24080.1 upstream_gene_variant ; 3249.0bp to feature; MODIFIER silent_mutation Average:84.278; most accessible tissue: Zhenshan97 root, score: 98.043 N N N N
vg0313678497 T -> C LOC_Os03g24090.1 downstream_gene_variant ; 1431.0bp to feature; MODIFIER silent_mutation Average:84.278; most accessible tissue: Zhenshan97 root, score: 98.043 N N N N
vg0313678497 T -> C LOC_Os03g24100.1 downstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:84.278; most accessible tissue: Zhenshan97 root, score: 98.043 N N N N
vg0313678497 T -> C LOC_Os03g24090-LOC_Os03g24100 intergenic_region ; MODIFIER silent_mutation Average:84.278; most accessible tissue: Zhenshan97 root, score: 98.043 N N N N
vg0313678497 T -> TC LOC_Os03g24080.1 upstream_gene_variant ; 3250.0bp to feature; MODIFIER silent_mutation Average:84.278; most accessible tissue: Zhenshan97 root, score: 98.043 N N N N
vg0313678497 T -> TC LOC_Os03g24090.1 downstream_gene_variant ; 1432.0bp to feature; MODIFIER silent_mutation Average:84.278; most accessible tissue: Zhenshan97 root, score: 98.043 N N N N
vg0313678497 T -> TC LOC_Os03g24100.1 downstream_gene_variant ; 203.0bp to feature; MODIFIER silent_mutation Average:84.278; most accessible tissue: Zhenshan97 root, score: 98.043 N N N N
vg0313678497 T -> TC LOC_Os03g24090-LOC_Os03g24100 intergenic_region ; MODIFIER silent_mutation Average:84.278; most accessible tissue: Zhenshan97 root, score: 98.043 N N N N
vg0313678497 T -> DEL N N silent_mutation Average:84.278; most accessible tissue: Zhenshan97 root, score: 98.043 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0313678497 T C 0.02 0.0 -0.01 -0.01 0.0 -0.02
vg0313678497 T TC 0.01 0.11 -0.03 0.05 0.05 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313678497 NA 1.61E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0313678497 NA 9.53E-06 mr1024 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 4.54E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 6.96E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 4.61E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 4.29E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 2.74E-08 mr1441 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 2.25E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 3.58E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 1.43E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 6.54E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 1.07E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 1.69E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313678497 NA 5.05E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251