\
| Variant ID: vg0313659201 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13659201 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CACCAATGTTCATTCAGTTCACCATCTATATGTCATCTTACGGTTAAATTTCTACCGTTCGGGAGGAAACTAAAAGATGCCTCTCATCTATACCTACCAT[T/C]
ATAACCCACTAAACTCCTAAAACTCAACATACATCAACCCACTAAGGTCAACATACATAATCCGTAATCACCTAAAACTCAACATGTAAGTATGCATATA
TATATGCATACTTACATGTTGAGTTTTAGGTGATTACGGATTATGTATGTTGACCTTAGTGGGTTGATGTATGTTGAGTTTTAGGAGTTTAGTGGGTTAT[A/G]
ATGGTAGGTATAGATGAGAGGCATCTTTTAGTTTCCTCCCGAACGGTAGAAATTTAACCGTAAGATGACATATAGATGGTGAACTGAATGAACATTGGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 5.20% | 1.57% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.60% | 15.90% | 4.43% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.70% | 2.60% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 55.80% | 36.90% | 7.34% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 14.50% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 4.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313659201 | T -> C | LOC_Os03g24050.1 | upstream_gene_variant ; 3911.0bp to feature; MODIFIER | silent_mutation | Average:51.095; most accessible tissue: Callus, score: 85.282 | N | N | N | N |
| vg0313659201 | T -> C | LOC_Os03g24060.1 | downstream_gene_variant ; 184.0bp to feature; MODIFIER | silent_mutation | Average:51.095; most accessible tissue: Callus, score: 85.282 | N | N | N | N |
| vg0313659201 | T -> C | LOC_Os03g24050-LOC_Os03g24060 | intergenic_region ; MODIFIER | silent_mutation | Average:51.095; most accessible tissue: Callus, score: 85.282 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313659201 | NA | 1.11E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313659201 | 1.13E-07 | 2.92E-37 | mr1699 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313659201 | NA | 2.19E-17 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313659201 | NA | 2.70E-15 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313659201 | NA | 3.87E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313659201 | NA | 9.47E-07 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |