\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313659201:

Variant ID: vg0313659201 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13659201
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCAATGTTCATTCAGTTCACCATCTATATGTCATCTTACGGTTAAATTTCTACCGTTCGGGAGGAAACTAAAAGATGCCTCTCATCTATACCTACCAT[T/C]
ATAACCCACTAAACTCCTAAAACTCAACATACATCAACCCACTAAGGTCAACATACATAATCCGTAATCACCTAAAACTCAACATGTAAGTATGCATATA

Reverse complement sequence

TATATGCATACTTACATGTTGAGTTTTAGGTGATTACGGATTATGTATGTTGACCTTAGTGGGTTGATGTATGTTGAGTTTTAGGAGTTTAGTGGGTTAT[A/G]
ATGGTAGGTATAGATGAGAGGCATCTTTTAGTTTCCTCCCGAACGGTAGAAATTTAACCGTAAGATGACATATAGATGGTGAACTGAATGAACATTGGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 5.20% 1.57% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 79.60% 15.90% 4.43% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 95.70% 2.60% 1.69% 0.00% NA
Tropical Japonica  504 55.80% 36.90% 7.34% 0.00% NA
Japonica Intermediate  241 78.40% 14.50% 7.05% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313659201 T -> C LOC_Os03g24050.1 upstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:51.095; most accessible tissue: Callus, score: 85.282 N N N N
vg0313659201 T -> C LOC_Os03g24060.1 downstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:51.095; most accessible tissue: Callus, score: 85.282 N N N N
vg0313659201 T -> C LOC_Os03g24050-LOC_Os03g24060 intergenic_region ; MODIFIER silent_mutation Average:51.095; most accessible tissue: Callus, score: 85.282 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313659201 NA 1.11E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313659201 1.13E-07 2.92E-37 mr1699 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313659201 NA 2.19E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313659201 NA 2.70E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313659201 NA 3.87E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313659201 NA 9.47E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251