\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313656815:

Variant ID: vg0313656815 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13656815
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTAGATTTTTCACTTATCCAAATACCCGTATGAGGTTTGTATTTAATAATTGAGAGAATATATTCTATGCCACTGAATTTGTTCGAGTTCAACAATTT[G/A]
CCATCGACATTCTCTTTCTATAATATACCGGCGACTTTATCAATTGTTCTACAATACGCCATTAGGTTGGGCATTCTTTTCAAAAAAATACCTAAAATAC

Reverse complement sequence

GTATTTTAGGTATTTTTTTGAAAAGAATGCCCAACCTAATGGCGTATTGTAGAACAATTGATAAAGTCGCCGGTATATTATAGAAAGAGAATGTCGATGG[C/T]
AAATTGTTGAACTCGAACAAATTCAGTGGCATAGAATATATTCTCTCAATTATTAAATACAAACCTCATACGGGTATTTGGATAAGTGAAAAATCTAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 18.10% 0.04% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 54.20% 45.70% 0.07% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 93.00% 7.00% 0.00% 0.00% NA
Tropical Japonica  504 9.70% 90.30% 0.00% 0.00% NA
Japonica Intermediate  241 24.10% 75.50% 0.41% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313656815 G -> A LOC_Os03g24050.1 upstream_gene_variant ; 1525.0bp to feature; MODIFIER silent_mutation Average:58.054; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0313656815 G -> A LOC_Os03g24060.1 downstream_gene_variant ; 2570.0bp to feature; MODIFIER silent_mutation Average:58.054; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0313656815 G -> A LOC_Os03g24050-LOC_Os03g24060 intergenic_region ; MODIFIER silent_mutation Average:58.054; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313656815 NA 1.97E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0313656815 NA 3.08E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 1.17E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 1.15E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 1.83E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 2.03E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 3.44E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 1.57E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 9.65E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 8.08E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 1.04E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 1.55E-15 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 4.47E-06 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 NA 5.20E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815 4.66E-06 NA mr1962_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251