Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0313656815:

Variant ID: vg0313656815 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 13656815
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTAGATTTTTCACTTATCCAAATACCCGTATGAGGTTTGTATTTAATAATTGAGAGAATATATTCTATGCCACTGAATTTGTTCGAGTTCAACAATTT[G/A]
CCATCGACATTCTCTTTCTATAATATACCGGCGACTTTATCAATTGTTCTACAATACGCCATTAGGTTGGGCATTCTTTTCAAAAAAATACCTAAAATAC

Reverse complement sequence

GTATTTTAGGTATTTTTTTGAAAAGAATGCCCAACCTAATGGCGTATTGTAGAACAATTGATAAAGTCGCCGGTATATTATAGAAAGAGAATGTCGATGG[C/T]
AAATTGTTGAACTCGAACAAATTCAGTGGCATAGAATATATTCTCTCAATTATTAAATACAAACCTCATACGGGTATTTGGATAAGTGAAAAATCTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	18.10%	0.04%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	54.20%	45.70%	0.07%	0.00%	NA
Aus	269	76.20%	23.80%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	93.00%	7.00%	0.00%	0.00%	NA
Tropical Japonica	504	9.70%	90.30%	0.00%	0.00%	NA
Japonica Intermediate	241	24.10%	75.50%	0.41%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0313656815	G -> A	LOC_Os03g24050.1	upstream_gene_variant ; 1525.0bp to feature; MODIFIER	silent_mutation	Average:58.054; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg0313656815	G -> A	LOC_Os03g24060.1	downstream_gene_variant ; 2570.0bp to feature; MODIFIER	silent_mutation	Average:58.054; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg0313656815	G -> A	LOC_Os03g24050-LOC_Os03g24060	intergenic_region ; MODIFIER	silent_mutation	Average:58.054; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0313656815	NA	1.97E-14	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0313656815	NA	3.08E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	1.17E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	1.15E-13	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	1.83E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	2.03E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	3.44E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	1.57E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	9.65E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	8.08E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	1.04E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	1.55E-15	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	4.47E-06	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	NA	5.20E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656815	4.66E-06	NA	mr1962_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251