Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313656312:

Variant ID: vg0313656312 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13656312
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTGAAGGAAGGCCCTGCTGCCGCTGCCCCTATCACTCGCTCTACCAAAAGGCATCGCTTGCTCGGAGTCATGCTAACGCGGGAACGAGCGGATTCGGC[G/A]
AGGCTAGCCAGGGGGGTCAACGCGTCCCGTCACCGCCTTCCCTCATTTGCTTGGCACCCGATTTAGGACGTAGGAGAGGACAATGCAGATCTGGAAGCTT

Reverse complement sequence

AAGCTTCCAGATCTGCATTGTCCTCTCCTACGTCCTAAATCGGGTGCCAAGCAAATGAGGGAAGGCGGTGACGGGACGCGTTGACCCCCCTGGCTAGCCT[C/T]
GCCGAATCCGCTCGTTCCCGCGTTAGCATGACTCCGAGCAAGCGATGCCTTTTGGTAGAGCGAGTGATAGGGGCAGCGGCAGCAGGGCCTTCCTTCACCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.80% 0.19% 0.00% NA
All Indica  2759 82.60% 17.40% 0.00% 0.00% NA
All Japonica  1512 53.50% 46.20% 0.26% 0.00% NA
Aus  269 20.80% 79.20% 0.00% 0.00% NA
Indica I  595 87.90% 12.10% 0.00% 0.00% NA
Indica II  465 43.90% 56.10% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 82.80% 17.20% 0.00% 0.00% NA
Temperate Japonica  767 92.80% 7.20% 0.00% 0.00% NA
Tropical Japonica  504 8.90% 90.50% 0.60% 0.00% NA
Japonica Intermediate  241 21.60% 78.00% 0.41% 0.00% NA
VI/Aromatic  96 14.60% 84.40% 1.04% 0.00% NA
Intermediate  90 60.00% 35.60% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313656312 G -> A LOC_Os03g24050.1 upstream_gene_variant ; 1022.0bp to feature; MODIFIER silent_mutation Average:75.14; most accessible tissue: Callus, score: 91.082 N N N N
vg0313656312 G -> A LOC_Os03g24060.1 downstream_gene_variant ; 3073.0bp to feature; MODIFIER silent_mutation Average:75.14; most accessible tissue: Callus, score: 91.082 N N N N
vg0313656312 G -> A LOC_Os03g24050-LOC_Os03g24060 intergenic_region ; MODIFIER silent_mutation Average:75.14; most accessible tissue: Callus, score: 91.082 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0313656312 G A 0.04 0.02 0.02 0.03 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313656312 NA 1.97E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0313656312 NA 3.08E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 9.98E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 1.83E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 9.61E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 2.40E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 1.67E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 2.03E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 3.44E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 3.00E-06 NA mr1100_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 2.86E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 4.09E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 9.65E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 8.08E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 4.82E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 5.20E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313656312 NA 3.19E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251