\
| Variant ID: vg0313617458 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13617458 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
CTTCAATAAGTCGCTCGTAAAACATATGGTATTTGAAAAAGGCAAGCGAATACGTGTGGTCGAGAAGGACGCTGAGGCGGTTACTCAGGAATCAGACTCA[G/A]
CATATCCAGACTCCGATCTCCATGTCTCGCACATCTTCGGAGGTTCCACGACATACTCCTCAGAGCGAGAATACAAGAAGGTGAAACGTGAAGTTTGTTC
GAACAAACTTCACGTTTCACCTTCTTGTATTCTCGCTCTGAGGAGTATGTCGTGGAACCTCCGAAGATGTGCGAGACATGGAGATCGGAGTCTGGATATG[C/T]
TGAGTCTGATTCCTGAGTAACCGCCTCAGCGTCCTTCTCGACCACACGTATTCGCTTGCCTTTTTCAAATACCATATGTTTTACGAGCGACTTATTGAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 11.90% | 1.23% | 2.50% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 57.90% | 32.50% | 2.84% | 6.81% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.60% | 6.90% | 0.39% | 0.13% | NA |
| Tropical Japonica | 504 | 17.30% | 58.70% | 6.55% | 17.46% | NA |
| Japonica Intermediate | 241 | 32.40% | 58.90% | 2.90% | 5.81% | NA |
| VI/Aromatic | 96 | 19.80% | 54.20% | 13.54% | 12.50% | NA |
| Intermediate | 90 | 76.70% | 18.90% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313617458 | G -> A | LOC_Os03g23990.1 | missense_variant ; p.Ala563Thr; MODERATE | nonsynonymous_codon ; A563T | Average:47.96; most accessible tissue: Minghui63 flag leaf, score: 73.334 | possibly damaging |
1.571 |
DELETERIOUS | 0.05 |
| vg0313617458 | G -> DEL | LOC_Os03g23990.1 | N | frameshift_variant | Average:47.96; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313617458 | NA | 2.88E-14 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 1.46E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 3.15E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 5.79E-07 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 2.10E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 3.44E-17 | mr1330 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 7.22E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 2.63E-11 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 1.71E-11 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 1.35E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 9.37E-13 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 8.46E-13 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | 4.06E-06 | 3.01E-15 | mr1579 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 3.91E-06 | mr1579 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 6.81E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 9.90E-17 | mr1701 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 8.01E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 1.89E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313617458 | NA | 3.82E-21 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |