Search for Variation information by Variation ID:
Detailed information for vg0313463686:
| Variant ID: vg0313463686 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13463686 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.32, others allele: 0.00, population size: 54. )
Flanking Sequence (100 bp) in Reference Genome:
TCAAGGCCGCAGGGACGCTCAAGGTCAGCAGCGTCTGTGCTTCAACTGCTTCGAGCCCGGGCACTTTGCGGATAAATGCCCGAAGCCAAGGCGTCAGCAA[A/G]
GCCAAGTGCCTCCCCGCTCCAACAACGGTGGGAAGGACGTCATTCGGGGTCGTGTGAACCATGTGACGGCCGAGGACGTGCTGACAACTCCAGACGTCAT
Reverse complement sequence
ATGACGTCTGGAGTTGTCAGCACGTCCTCGGCCGTCACATGGTTCACACGACCCCGAATGACGTCCTTCCCACCGTTGTTGGAGCGGGGAGGCACTTGGC[T/C]
TTGCTGACGCCTTGGCTTCGGGCATTTATCCGCAAAGTGCCCGGGCTCGAAGCAGTTGAAGCACAGACGCTGCTGACCTTGAGCGTCCCTGCGGCCTTGA
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.70% | 3.70% | 59.63% | 9.04% | NA |
| All Indica | 2759 | 12.70% | 5.90% | 77.06% | 4.31% | NA |
| All Japonica | 1512 | 59.70% | 0.30% | 19.91% | 20.11% | NA |
| Aus | 269 | 7.10% | 1.50% | 91.08% | 0.37% | NA |
| Indica I | 595 | 27.40% | 1.00% | 64.37% | 7.23% | NA |
| Indica II | 465 | 10.10% | 9.00% | 78.28% | 2.58% | NA |
| Indica III | 913 | 3.00% | 7.90% | 86.64% | 2.52% | NA |
| Indica Intermediate | 786 | 14.40% | 5.60% | 74.81% | 5.22% | NA |
| Temperate Japonica | 767 | 94.30% | 0.00% | 1.69% | 4.04% | NA |
| Tropical Japonica | 504 | 17.50% | 0.40% | 45.24% | 36.90% | NA |
| Japonica Intermediate | 241 | 38.20% | 0.80% | 24.90% | 36.10% | NA |
| VI/Aromatic | 96 | 6.20% | 1.00% | 89.58% | 3.12% | NA |
| Intermediate | 90 | 32.20% | 1.10% | 66.67% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313463686 | A -> DEL | LOC_Os03g23760.1 | N | frameshift_variant | Average:25.476; most accessible tissue: Callus, score: 43.184 | N | N | N | N |
| vg0313463686 | A -> G | LOC_Os03g23760.1 | missense_variant ; p.Ser644Gly; MODERATE | nonsynonymous_codon ; S644G | Average:25.476; most accessible tissue: Callus, score: 43.184 | possibly damaging  |
-1.808 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313463686 | 2.65E-07 | 1.52E-07 | mr1037_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313463686 | NA | 9.23E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313463686 | NA | 6.79E-07 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313463686 | NA | 8.56E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313463686 | NA | 2.94E-12 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313463686 | NA | 4.66E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |