Variant ID: vg0313459666 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 13459666 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATTTAAATGAAGAAATTCGTAAATATCCATTTAAAGAGCATATAAACTTCAAATGGCCATACCTTGGCCATTTGAACTCGGAATTGGACCGTTCAAGTC[C/T]
CTAATTTTTCCTTAAGATGTAAAGAACCCATTTTTGTGCTTTGTTTCTGCTGTTATGTGGAGTTATTTAGTGGTTAAGCCTTTTCTTTTCCGTTGGTCGT
ACGACCAACGGAAAAGAAAAGGCTTAACCACTAAATAACTCCACATAACAGCAGAAACAAAGCACAAAAATGGGTTCTTTACATCTTAAGGAAAAATTAG[G/A]
GACTTGAACGGTCCAATTCCGAGTTCAAATGGCCAAGGTATGGCCATTTGAAGTTTATATGCTCTTTAAATGGATATTTACGAATTTCTTCATTTAAATT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 23.80% | 21.30% | 25.62% | 29.22% | NA |
All Indica | 2759 | 8.30% | 35.30% | 33.89% | 22.51% | NA |
All Japonica | 1512 | 56.80% | 0.70% | 5.69% | 36.84% | NA |
Aus | 269 | 3.70% | 1.90% | 50.19% | 44.24% | NA |
Indica I | 595 | 18.80% | 14.80% | 40.67% | 25.71% | NA |
Indica II | 465 | 6.50% | 9.20% | 38.92% | 45.38% | NA |
Indica III | 913 | 1.50% | 65.80% | 25.85% | 6.79% | NA |
Indica Intermediate | 786 | 9.20% | 30.90% | 35.11% | 24.81% | NA |
Temperate Japonica | 767 | 93.70% | 0.10% | 0.39% | 5.74% | NA |
Tropical Japonica | 504 | 13.50% | 1.60% | 12.90% | 72.02% | NA |
Japonica Intermediate | 241 | 29.90% | 0.40% | 7.47% | 62.24% | NA |
VI/Aromatic | 96 | 2.10% | 7.30% | 29.17% | 61.46% | NA |
Intermediate | 90 | 28.90% | 13.30% | 30.00% | 27.78% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0313459666 | C -> T | LOC_Os03g23760.1 | upstream_gene_variant ; 727.0bp to feature; MODIFIER | silent_mutation | Average:31.098; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0313459666 | C -> T | LOC_Os03g23250.1 | downstream_gene_variant ; 1529.0bp to feature; MODIFIER | silent_mutation | Average:31.098; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0313459666 | C -> T | LOC_Os03g23250-LOC_Os03g23760 | intergenic_region ; MODIFIER | silent_mutation | Average:31.098; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0313459666 | C -> DEL | N | N | silent_mutation | Average:31.098; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0313459666 | NA | 6.92E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 1.51E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 9.90E-13 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 5.01E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 1.41E-07 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 8.40E-21 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 6.79E-06 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 2.00E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | 1.46E-07 | NA | mr1842_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 1.04E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 4.91E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0313459666 | NA | 3.85E-09 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |