Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313216687:

Variant ID: vg0313216687 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 13216687
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGATTCGACTAGATCACCCGGCGACTTGGCTCCTGTAGGCTCCGGCTTCGTAGGCTGTGGTGGATGTGTTGGCGGTAAGATTCGATGCCCTAGGTCCTC[T/C]
CCGGGGGGTCCCTTTTATACCGCAGGTCAACTGGTCTCCAAGTAGGACTCGGAGACATCGGACCCGATACGATATAATGACGACCCAGTTCAATCCGAGT

Reverse complement sequence

ACTCGGATTGAACTGGGTCGTCATTATATCGTATCGGGTCCGATGTCTCCGAGTCCTACTTGGAGACCAGTTGACCTGCGGTATAAAAGGGACCCCCCGG[A/G]
GAGGACCTAGGGCATCGAATCTTACCGCCAACACATCCACCACAGCCTACGAAGCCGGAGCCTACAGGAGCCAAGTCGCCGGGTGATCTAGTCGAATCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.70%	18.00%	8.70%	50.57%	NA
All Indica	2759	7.00%	0.80%	13.99%	78.22%	NA
All Japonica	1512	56.30%	43.30%	0.07%	0.40%	NA
Aus	269	4.80%	25.30%	3.35%	66.54%	NA
Indica I	595	5.00%	0.00%	7.56%	87.39%	NA
Indica II	465	5.60%	0.40%	8.60%	85.38%	NA
Indica III	913	9.30%	1.00%	21.80%	67.91%	NA
Indica Intermediate	786	6.50%	1.50%	12.98%	79.01%	NA
Temperate Japonica	767	95.70%	4.20%	0.00%	0.13%	NA
Tropical Japonica	504	7.70%	91.70%	0.20%	0.40%	NA
Japonica Intermediate	241	32.40%	66.40%	0.00%	1.24%	NA
VI/Aromatic	96	2.10%	81.20%	2.08%	14.58%	NA
Intermediate	90	18.90%	30.00%	14.44%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0313216687	T -> C	LOC_Os03g22850.1	upstream_gene_variant ; 2806.0bp to feature; MODIFIER	silent_mutation	Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096	N	N	N	N
vg0313216687	T -> C	LOC_Os03g22860.1	upstream_gene_variant ; 371.0bp to feature; MODIFIER	silent_mutation	Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096	N	N	N	N
vg0313216687	T -> C	LOC_Os03g22870.1	upstream_gene_variant ; 1367.0bp to feature; MODIFIER	silent_mutation	Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096	N	N	N	N
vg0313216687	T -> C	LOC_Os03g22870.4	upstream_gene_variant ; 1364.0bp to feature; MODIFIER	silent_mutation	Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096	N	N	N	N
vg0313216687	T -> C	LOC_Os03g22870.5	upstream_gene_variant ; 1364.0bp to feature; MODIFIER	silent_mutation	Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096	N	N	N	N
vg0313216687	T -> C	LOC_Os03g22870.2	upstream_gene_variant ; 1364.0bp to feature; MODIFIER	silent_mutation	Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096	N	N	N	N
vg0313216687	T -> C	LOC_Os03g22870.3	upstream_gene_variant ; 1364.0bp to feature; MODIFIER	silent_mutation	Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096	N	N	N	N
vg0313216687	T -> C	LOC_Os03g22860-LOC_Os03g22870	intergenic_region ; MODIFIER	silent_mutation	Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096	N	N	N	N
vg0313216687	T -> DEL	N	N	silent_mutation	Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0313216687	NA	4.17E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0313216687	NA	6.09E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	2.18E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	4.30E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	3.10E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.04E-35	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	9.49E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	5.72E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	2.95E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.27E-31	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	4.68E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	2.28E-14	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	2.43E-13	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.17E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	8.93E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	4.63E-16	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	3.64E-16	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.57E-09	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.84E-24	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	8.20E-33	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	2.33E-58	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	2.24E-23	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	8.75E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	2.16E-09	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.50E-26	mr1361_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	9.93E-13	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.63E-35	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.40E-12	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	8.45E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	5.22E-28	mr1584_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	7.53E-10	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	4.89E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	9.17E-17	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	4.52E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.32E-30	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	6.77E-11	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.33E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	7.41E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	6.59E-14	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	2.55E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.27E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	1.68E-11	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687	NA	2.09E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251