\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313216687:

Variant ID: vg0313216687 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13216687
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATTCGACTAGATCACCCGGCGACTTGGCTCCTGTAGGCTCCGGCTTCGTAGGCTGTGGTGGATGTGTTGGCGGTAAGATTCGATGCCCTAGGTCCTC[T/C]
CCGGGGGGTCCCTTTTATACCGCAGGTCAACTGGTCTCCAAGTAGGACTCGGAGACATCGGACCCGATACGATATAATGACGACCCAGTTCAATCCGAGT

Reverse complement sequence

ACTCGGATTGAACTGGGTCGTCATTATATCGTATCGGGTCCGATGTCTCCGAGTCCTACTTGGAGACCAGTTGACCTGCGGTATAAAAGGGACCCCCCGG[A/G]
GAGGACCTAGGGCATCGAATCTTACCGCCAACACATCCACCACAGCCTACGAAGCCGGAGCCTACAGGAGCCAAGTCGCCGGGTGATCTAGTCGAATCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.70% 18.00% 8.70% 50.57% NA
All Indica  2759 7.00% 0.80% 13.99% 78.22% NA
All Japonica  1512 56.30% 43.30% 0.07% 0.40% NA
Aus  269 4.80% 25.30% 3.35% 66.54% NA
Indica I  595 5.00% 0.00% 7.56% 87.39% NA
Indica II  465 5.60% 0.40% 8.60% 85.38% NA
Indica III  913 9.30% 1.00% 21.80% 67.91% NA
Indica Intermediate  786 6.50% 1.50% 12.98% 79.01% NA
Temperate Japonica  767 95.70% 4.20% 0.00% 0.13% NA
Tropical Japonica  504 7.70% 91.70% 0.20% 0.40% NA
Japonica Intermediate  241 32.40% 66.40% 0.00% 1.24% NA
VI/Aromatic  96 2.10% 81.20% 2.08% 14.58% NA
Intermediate  90 18.90% 30.00% 14.44% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313216687 T -> C LOC_Os03g22850.1 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096 N N N N
vg0313216687 T -> C LOC_Os03g22860.1 upstream_gene_variant ; 371.0bp to feature; MODIFIER silent_mutation Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096 N N N N
vg0313216687 T -> C LOC_Os03g22870.1 upstream_gene_variant ; 1367.0bp to feature; MODIFIER silent_mutation Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096 N N N N
vg0313216687 T -> C LOC_Os03g22870.4 upstream_gene_variant ; 1364.0bp to feature; MODIFIER silent_mutation Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096 N N N N
vg0313216687 T -> C LOC_Os03g22870.5 upstream_gene_variant ; 1364.0bp to feature; MODIFIER silent_mutation Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096 N N N N
vg0313216687 T -> C LOC_Os03g22870.2 upstream_gene_variant ; 1364.0bp to feature; MODIFIER silent_mutation Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096 N N N N
vg0313216687 T -> C LOC_Os03g22870.3 upstream_gene_variant ; 1364.0bp to feature; MODIFIER silent_mutation Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096 N N N N
vg0313216687 T -> C LOC_Os03g22860-LOC_Os03g22870 intergenic_region ; MODIFIER silent_mutation Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096 N N N N
vg0313216687 T -> DEL N N silent_mutation Average:49.845; most accessible tissue: Minghui63 flower, score: 65.096 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313216687 NA 4.17E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0313216687 NA 6.09E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 2.18E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 4.30E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 3.10E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.04E-35 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 9.49E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 5.72E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 2.95E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.27E-31 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 4.68E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 2.28E-14 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 2.43E-13 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.17E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 8.93E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 4.63E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 3.64E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.57E-09 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.84E-24 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 8.20E-33 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 2.33E-58 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 2.24E-23 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 8.75E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 2.16E-09 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.50E-26 mr1361_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 9.93E-13 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.63E-35 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.40E-12 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 8.45E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 5.22E-28 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 7.53E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 4.89E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 9.17E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 4.52E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.32E-30 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 6.77E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.33E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 7.41E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 6.59E-14 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 2.55E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.27E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 1.68E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313216687 NA 2.09E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251