\
| Variant ID: vg0313207043 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13207043 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGCCCCCAGCCGTGAAGTTGGAAAGTTTATTTCCGATTACACGGCTTGGTTAATACGCATGGCGAGAACTCTTACACGACCAGATCTTACATGGTCTTT[T/C]
GTCTCTACAGGATCCGACAAGGTCTTATCGGCTCTGGGCGGCCCCAGCTGAAGTTCCCTTAGGTTCCTCGGAGGCCTTGTTAAGACAGCGTAAAGGGACA
TGTCCCTTTACGCTGTCTTAACAAGGCCTCCGAGGAACCTAAGGGAACTTCAGCTGGGGCCGCCCAGAGCCGATAAGACCTTGTCGGATCCTGTAGAGAC[A/G]
AAAGACCATGTAAGATCTGGTCGTGTAAGAGTTCTCGCCATGCGTATTAACCAAGCCGTGTAATCGGAAATAAACTTTCCAACTTCACGGCTGGGGGCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.90% | 18.50% | 31.95% | 9.61% | NA |
| All Indica | 2759 | 32.60% | 0.30% | 51.79% | 15.37% | NA |
| All Japonica | 1512 | 43.20% | 56.30% | 0.26% | 0.20% | NA |
| Aus | 269 | 75.50% | 1.10% | 16.73% | 6.69% | NA |
| Indica I | 595 | 22.40% | 0.30% | 56.30% | 21.01% | NA |
| Indica II | 465 | 61.50% | 0.20% | 33.33% | 4.95% | NA |
| Indica III | 913 | 26.00% | 0.00% | 57.83% | 16.21% | NA |
| Indica Intermediate | 786 | 30.90% | 0.50% | 52.29% | 16.28% | NA |
| Temperate Japonica | 767 | 4.30% | 95.60% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 91.50% | 7.70% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 66.00% | 33.20% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 10.42% | 2.08% | NA |
| Intermediate | 90 | 54.40% | 13.30% | 24.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313207043 | T -> C | LOC_Os03g22840.1 | downstream_gene_variant ; 457.0bp to feature; MODIFIER | silent_mutation | Average:23.981; most accessible tissue: Minghui63 flag leaf, score: 32.882 | N | N | N | N |
| vg0313207043 | T -> C | LOC_Os03g22850.1 | downstream_gene_variant ; 709.0bp to feature; MODIFIER | silent_mutation | Average:23.981; most accessible tissue: Minghui63 flag leaf, score: 32.882 | N | N | N | N |
| vg0313207043 | T -> C | LOC_Os03g22840-LOC_Os03g22850 | intergenic_region ; MODIFIER | silent_mutation | Average:23.981; most accessible tissue: Minghui63 flag leaf, score: 32.882 | N | N | N | N |
| vg0313207043 | T -> DEL | N | N | silent_mutation | Average:23.981; most accessible tissue: Minghui63 flag leaf, score: 32.882 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313207043 | NA | 4.17E-11 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0313207043 | NA | 4.30E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 9.49E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 2.43E-13 | mr1879 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | 1.29E-06 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | 2.16E-07 | NA | mr1080_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 1.57E-09 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | 1.07E-06 | NA | mr1100_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | 1.13E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 2.69E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 8.75E-08 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 2.16E-09 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 1.22E-20 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 9.93E-13 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 1.40E-12 | mr1368_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 8.45E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 7.53E-10 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | 9.22E-07 | NA | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 4.52E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 6.77E-11 | mr1789_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 1.33E-07 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | 6.29E-06 | NA | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 2.55E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313207043 | NA | 2.09E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |