RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0313149395:

Variant ID: vg0313149395 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 13149395
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTATTTTTATAAAAAATTATAGTGCACTTACATATCATATCAACTGAATTTACAAATGTAATTTTAGTTATGTAGGACTGTAATTTTATATTTTAAAAT[A/G]
TAATTTTAGTTATATAAGACTGTAATTTTATTTTTTTTAAAAAAATAACAAATACATATTTACTTATACCAAAATTACAGTGCACTTACATGTCATATCA

Reverse complement sequence

TGATATGACATGTAAGTGCACTGTAATTTTGGTATAAGTAAATATGTATTTGTTATTTTTTTAAAAAAAATAAAATTACAGTCTTATATAACTAAAATTA[T/C]
ATTTTAAAATATAAAATTACAGTCCTACATAACTAAAATTACATTTGTAAATTCAGTTGATATGATATGTAAGTGCACTATAATTTTTTATAAAAATAAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	9.60%	1.54%	0.00%	NA
All Indica	2759	98.20%	0.10%	1.70%	0.00%	NA
All Japonica	1512	70.20%	28.40%	1.32%	0.00%	NA
Aus	269	91.80%	6.30%	1.86%	0.00%	NA
Indica I	595	98.00%	0.00%	2.02%	0.00%	NA
Indica II	465	96.10%	0.00%	3.87%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	97.70%	0.30%	2.04%	0.00%	NA
Temperate Japonica	767	57.60%	40.20%	2.22%	0.00%	NA
Tropical Japonica	504	89.90%	9.90%	0.20%	0.00%	NA
Japonica Intermediate	241	69.30%	29.90%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0313149395	A -> G	LOC_Os03g22770.1	upstream_gene_variant ; 3565.0bp to feature; MODIFIER	silent_mutation	Average:35.538; most accessible tissue: Zhenshan97 flag leaf, score: 58.104	N	N	N	N
vg0313149395	A -> G	LOC_Os03g22770.2	upstream_gene_variant ; 3565.0bp to feature; MODIFIER	silent_mutation	Average:35.538; most accessible tissue: Zhenshan97 flag leaf, score: 58.104	N	N	N	N
vg0313149395	A -> G	LOC_Os03g22760.1	downstream_gene_variant ; 287.0bp to feature; MODIFIER	silent_mutation	Average:35.538; most accessible tissue: Zhenshan97 flag leaf, score: 58.104	N	N	N	N
vg0313149395	A -> G	LOC_Os03g22760-LOC_Os03g22770	intergenic_region ; MODIFIER	silent_mutation	Average:35.538; most accessible tissue: Zhenshan97 flag leaf, score: 58.104	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0313149395	NA	2.81E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313149395	NA	7.35E-09	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313149395	4.78E-06	NA	mr1530_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0313149395:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact