Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313149208:

Variant ID: vg0313149208 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 13149208
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGTACTCGTGATGTTTTTCTATGTATGGATCAAATGTTGCAGTGGATTTTAAATATTGTTTAATGGGTCTGTCTATTCATTTGTCGTGTGATTTCTAAC[A/C]
AAAAAAAATCACCCAAATTTTTTCTGCCTTTATATTTACATACAACGAACTACAAAAGAAAATAAAAAATACATATTTACTCACACATTATTTTTATAAA

Reverse complement sequence

TTTATAAAAATAATGTGTGAGTAAATATGTATTTTTTATTTTCTTTTGTAGTTCGTTGTATGTAAATATAAAGGCAGAAAAAATTTGGGTGATTTTTTTT[T/G]
GTTAGAAATCACACGACAAATGAATAGACAGACCCATTAAACAATATTTAAAATCCACTGCAACATTTGATCCATACATAGAAAAACATCACGAGTACAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.30%	15.80%	0.91%	0.00%	NA
All Indica	2759	89.70%	10.30%	0.00%	0.00%	NA
All Japonica	1512	68.60%	28.60%	2.78%	0.00%	NA
Aus	269	93.30%	6.30%	0.37%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	78.40%	21.60%	0.00%	0.00%	NA
Indica Intermediate	786	90.50%	9.50%	0.00%	0.00%	NA
Temperate Japonica	767	54.40%	40.70%	4.95%	0.00%	NA
Tropical Japonica	504	89.90%	9.90%	0.20%	0.00%	NA
Japonica Intermediate	241	69.30%	29.50%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0313149208	A -> C	LOC_Os03g22770.1	upstream_gene_variant ; 3752.0bp to feature; MODIFIER	silent_mutation	Average:65.028; most accessible tissue: Zhenshan97 flag leaf, score: 86.987	N	N	N	N
vg0313149208	A -> C	LOC_Os03g22770.2	upstream_gene_variant ; 3752.0bp to feature; MODIFIER	silent_mutation	Average:65.028; most accessible tissue: Zhenshan97 flag leaf, score: 86.987	N	N	N	N
vg0313149208	A -> C	LOC_Os03g22760.1	downstream_gene_variant ; 100.0bp to feature; MODIFIER	silent_mutation	Average:65.028; most accessible tissue: Zhenshan97 flag leaf, score: 86.987	N	N	N	N
vg0313149208	A -> C	LOC_Os03g22760-LOC_Os03g22770	intergenic_region ; MODIFIER	silent_mutation	Average:65.028; most accessible tissue: Zhenshan97 flag leaf, score: 86.987	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0313149208	NA	2.15E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313149208	7.08E-06	1.67E-08	mr1708	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313149208	NA	8.45E-09	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251