\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313119247:

Variant ID: vg0313119247 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13119247
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


CATTCCCATCCAAAGCAGCGACTGATTGGGTTTTTCCATATGATTCCTCTATCAAGAAAATATCCCAATATATTGGTACCTCATATTCGTTCATGGTCAC[C/T]
GGCTTTCAAGATATTATTATATGATCATCCTACGATATCTTCTTTTCAAGATATTACTAAGCATTTCTTCTGTAAAAACACCGTCAGGATTTTCATGTAT

Reverse complement sequence

ATACATGAAAATCCTGACGGTGTTTTTACAGAAGAAATGCTTAGTAATATCTTGAAAAGAAGATATCGTAGGATGATCATATAATAATATCTTGAAAGCC[G/A]
GTGACCATGAACGAATATGAGGTACCAATATATTGGGATATTTTCTTGATAGAGGAATCATATGGAAAAACCCAATCAGTCGCTGCTTTGGATGGGAATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 4.40% 0.02% 0.00% NA
All Indica  2759 95.80% 4.20% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 92.40% 7.60% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 95.70% 4.30% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.60% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313119247 C -> T LOC_Os03g22700.1 upstream_gene_variant ; 3511.0bp to feature; MODIFIER silent_mutation Average:49.033; most accessible tissue: Callus, score: 76.216 N N N N
vg0313119247 C -> T LOC_Os03g22720.1 downstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:49.033; most accessible tissue: Callus, score: 76.216 N N N N
vg0313119247 C -> T LOC_Os03g22720.2 downstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:49.033; most accessible tissue: Callus, score: 76.216 N N N N
vg0313119247 C -> T LOC_Os03g22720.3 downstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:49.033; most accessible tissue: Callus, score: 76.216 N N N N
vg0313119247 C -> T LOC_Os03g22700-LOC_Os03g22720 intergenic_region ; MODIFIER silent_mutation Average:49.033; most accessible tissue: Callus, score: 76.216 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313119247 NA 3.09E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247 NA 5.27E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247 NA 6.03E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247 1.48E-07 1.30E-09 mr1275 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247 NA 4.45E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247 NA 2.12E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247 NA 4.51E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247 NA 6.64E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247 4.76E-07 NA mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247 NA 2.99E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251