Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313119247:

Variant ID: vg0313119247 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 13119247
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

CATTCCCATCCAAAGCAGCGACTGATTGGGTTTTTCCATATGATTCCTCTATCAAGAAAATATCCCAATATATTGGTACCTCATATTCGTTCATGGTCAC[C/T]
GGCTTTCAAGATATTATTATATGATCATCCTACGATATCTTCTTTTCAAGATATTACTAAGCATTTCTTCTGTAAAAACACCGTCAGGATTTTCATGTAT

Reverse complement sequence

ATACATGAAAATCCTGACGGTGTTTTTACAGAAGAAATGCTTAGTAATATCTTGAAAAGAAGATATCGTAGGATGATCATATAATAATATCTTGAAAGCC[G/A]
GTGACCATGAACGAATATGAGGTACCAATATATTGGGATATTTTCTTGATAGAGGAATCATATGGAAAAACCCAATCAGTCGCTGCTTTGGATGGGAATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	4.40%	0.02%	0.00%	NA
All Indica	2759	95.80%	4.20%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	68.00%	32.00%	0.00%	0.00%	NA
Indica I	595	92.40%	7.60%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	95.70%	4.30%	0.00%	0.00%	NA
Indica Intermediate	786	96.30%	3.60%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0313119247	C -> T	LOC_Os03g22700.1	upstream_gene_variant ; 3511.0bp to feature; MODIFIER	silent_mutation	Average:49.033; most accessible tissue: Callus, score: 76.216	N	N	N	N
vg0313119247	C -> T	LOC_Os03g22720.1	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:49.033; most accessible tissue: Callus, score: 76.216	N	N	N	N
vg0313119247	C -> T	LOC_Os03g22720.2	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:49.033; most accessible tissue: Callus, score: 76.216	N	N	N	N
vg0313119247	C -> T	LOC_Os03g22720.3	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:49.033; most accessible tissue: Callus, score: 76.216	N	N	N	N
vg0313119247	C -> T	LOC_Os03g22700-LOC_Os03g22720	intergenic_region ; MODIFIER	silent_mutation	Average:49.033; most accessible tissue: Callus, score: 76.216	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0313119247	NA	3.09E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247	NA	5.27E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247	NA	6.03E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247	1.48E-07	1.30E-09	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247	NA	4.45E-06	mr1400	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247	NA	2.12E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247	NA	4.51E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247	NA	6.64E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247	4.76E-07	NA	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313119247	NA	2.99E-06	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251