\
| Variant ID: vg0313119247 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13119247 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )
CATTCCCATCCAAAGCAGCGACTGATTGGGTTTTTCCATATGATTCCTCTATCAAGAAAATATCCCAATATATTGGTACCTCATATTCGTTCATGGTCAC[C/T]
GGCTTTCAAGATATTATTATATGATCATCCTACGATATCTTCTTTTCAAGATATTACTAAGCATTTCTTCTGTAAAAACACCGTCAGGATTTTCATGTAT
ATACATGAAAATCCTGACGGTGTTTTTACAGAAGAAATGCTTAGTAATATCTTGAAAAGAAGATATCGTAGGATGATCATATAATAATATCTTGAAAGCC[G/A]
GTGACCATGAACGAATATGAGGTACCAATATATTGGGATATTTTCTTGATAGAGGAATCATATGGAAAAACCCAATCAGTCGCTGCTTTGGATGGGAATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 4.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 4.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313119247 | C -> T | LOC_Os03g22700.1 | upstream_gene_variant ; 3511.0bp to feature; MODIFIER | silent_mutation | Average:49.033; most accessible tissue: Callus, score: 76.216 | N | N | N | N |
| vg0313119247 | C -> T | LOC_Os03g22720.1 | downstream_gene_variant ; 3320.0bp to feature; MODIFIER | silent_mutation | Average:49.033; most accessible tissue: Callus, score: 76.216 | N | N | N | N |
| vg0313119247 | C -> T | LOC_Os03g22720.2 | downstream_gene_variant ; 3320.0bp to feature; MODIFIER | silent_mutation | Average:49.033; most accessible tissue: Callus, score: 76.216 | N | N | N | N |
| vg0313119247 | C -> T | LOC_Os03g22720.3 | downstream_gene_variant ; 3320.0bp to feature; MODIFIER | silent_mutation | Average:49.033; most accessible tissue: Callus, score: 76.216 | N | N | N | N |
| vg0313119247 | C -> T | LOC_Os03g22700-LOC_Os03g22720 | intergenic_region ; MODIFIER | silent_mutation | Average:49.033; most accessible tissue: Callus, score: 76.216 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313119247 | NA | 3.09E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313119247 | NA | 5.27E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313119247 | NA | 6.03E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313119247 | 1.48E-07 | 1.30E-09 | mr1275 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313119247 | NA | 4.45E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313119247 | NA | 2.12E-07 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313119247 | NA | 4.51E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313119247 | NA | 6.64E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313119247 | 4.76E-07 | NA | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313119247 | NA | 2.99E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |