\
| Variant ID: vg0313073263 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13073263 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 120. )
TAGTTGAATATCTATTATATTATTAAAGGAATAGAAAAAGGAGCCTCCACATTCGCTCACATGGCCTAGAAATTTTCACATTAATCGGGAAAAAAGAAAA[A/G]
ACAGAGTCCATATAGAAATACAATTTAGAAATAGCAGAAATTCGAAATTAAAAAATAAGGAATATTAGAAAAGGAGACTAGAGTCCATATAGAAATACAA
TTGTATTTCTATATGGACTCTAGTCTCCTTTTCTAATATTCCTTATTTTTTAATTTCGAATTTCTGCTATTTCTAAATTGTATTTCTATATGGACTCTGT[T/C]
TTTTCTTTTTTCCCGATTAATGTGAAAATTTCTAGGCCATGTGAGCGAATGTGGAGGCTCCTTTTTCTATTCCTTTAATAATATAATAGATATTCAACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 87.10% | 12.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 80.90% | 18.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.90% | 13.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313073263 | A -> G | LOC_Os03g22634.1 | upstream_gene_variant ; 1790.0bp to feature; MODIFIER | silent_mutation | Average:20.923; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0313073263 | A -> G | LOC_Os03g22634-LOC_Os03g22650 | intergenic_region ; MODIFIER | silent_mutation | Average:20.923; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313073263 | NA | 2.29E-07 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313073263 | 6.95E-06 | 6.96E-06 | mr1275 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313073263 | 4.42E-07 | 4.42E-07 | mr1302 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313073263 | NA | 1.02E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313073263 | 3.69E-06 | 3.69E-06 | mr1762 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |