\
| Variant ID: vg0313016014 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 13016014 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGTTTTTCCATTCAATTATTTTTGATAGAATCGGCGAGCCGTCAATTTCATTTAGTAGAGAAGGGGTAAACTCTATAAAGCGAAAGGAAAGAGAAAAAA[G/T,A]
GATTTCAGGATCTTCGGTCCGAGGTAACTAAAAGAAAGCCAATTATGAAGATTTCTCACTCTTGCTAAGGTCCAAGTTTTAACCTCTTTCTTAATTTTGG
CCAAAATTAAGAAAGAGGTTAAAACTTGGACCTTAGCAAGAGTGAGAAATCTTCATAATTGGCTTTCTTTTAGTTACCTCGGACCGAAGATCCTGAAATC[C/A,T]
TTTTTTCTCTTTCCTTTCGCTTTATAGAGTTTACCCCTTCTCTACTAAATGAAATTGACGGCTCGCCGATTCTATCAAAAATAATTGAATGGAAAAACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 7.00% | 1.71% | 0.00% | A: 0.15% |
| All Indica | 2759 | 99.20% | 0.00% | 0.51% | 0.00% | A: 0.22% |
| All Japonica | 1512 | 74.00% | 21.60% | 4.43% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.00% | A: 0.37% |
| Indica I | 595 | 99.00% | 0.00% | 1.01% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.20% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.00% | 0.11% | 0.00% | A: 0.44% |
| Indica Intermediate | 786 | 99.40% | 0.00% | 0.38% | 0.00% | A: 0.25% |
| Temperate Japonica | 767 | 59.20% | 33.50% | 7.30% | 0.00% | NA |
| Tropical Japonica | 504 | 96.60% | 2.40% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.90% | 23.70% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0313016014 | G -> T | LOC_Os03g22590-LOC_Os03g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:30.608; most accessible tissue: Callus, score: 62.045 | N | N | N | N |
| vg0313016014 | G -> A | LOC_Os03g22590-LOC_Os03g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:30.608; most accessible tissue: Callus, score: 62.045 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0313016014 | 1.85E-06 | 3.48E-09 | mr1530 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313016014 | NA | 3.52E-08 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313016014 | 5.02E-06 | NA | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0313016014 | NA | 4.81E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |