\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0313016014:

Variant ID: vg0313016014 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 13016014
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTTTTTCCATTCAATTATTTTTGATAGAATCGGCGAGCCGTCAATTTCATTTAGTAGAGAAGGGGTAAACTCTATAAAGCGAAAGGAAAGAGAAAAAA[G/T,A]
GATTTCAGGATCTTCGGTCCGAGGTAACTAAAAGAAAGCCAATTATGAAGATTTCTCACTCTTGCTAAGGTCCAAGTTTTAACCTCTTTCTTAATTTTGG

Reverse complement sequence

CCAAAATTAAGAAAGAGGTTAAAACTTGGACCTTAGCAAGAGTGAGAAATCTTCATAATTGGCTTTCTTTTAGTTACCTCGGACCGAAGATCCTGAAATC[C/A,T]
TTTTTTCTCTTTCCTTTCGCTTTATAGAGTTTACCCCTTCTCTACTAAATGAAATTGACGGCTCGCCGATTCTATCAAAAATAATTGAATGGAAAAACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 7.00% 1.71% 0.00% A: 0.15%
All Indica  2759 99.20% 0.00% 0.51% 0.00% A: 0.22%
All Japonica  1512 74.00% 21.60% 4.43% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.00% A: 0.37%
Indica I  595 99.00% 0.00% 1.01% 0.00% NA
Indica II  465 98.90% 0.20% 0.86% 0.00% NA
Indica III  913 99.50% 0.00% 0.11% 0.00% A: 0.44%
Indica Intermediate  786 99.40% 0.00% 0.38% 0.00% A: 0.25%
Temperate Japonica  767 59.20% 33.50% 7.30% 0.00% NA
Tropical Japonica  504 96.60% 2.40% 0.99% 0.00% NA
Japonica Intermediate  241 73.90% 23.70% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0313016014 G -> T LOC_Os03g22590-LOC_Os03g22600 intergenic_region ; MODIFIER silent_mutation Average:30.608; most accessible tissue: Callus, score: 62.045 N N N N
vg0313016014 G -> A LOC_Os03g22590-LOC_Os03g22600 intergenic_region ; MODIFIER silent_mutation Average:30.608; most accessible tissue: Callus, score: 62.045 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0313016014 1.85E-06 3.48E-09 mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313016014 NA 3.52E-08 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313016014 5.02E-06 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0313016014 NA 4.81E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251