Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312973767:

Variant ID: vg0312973767 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 12973767
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

AGACCACCAGCTTACATGTTACGCCCAGTGCTCGTCGGGGCTTGGAGGGAGGCATTGGTTGGTATGGGCCCCATTTTAGTAAACCTGCAGCATGATGGAG[A/G]
CACTAGTAGGTGCCATGGTCGATGGATCCACACGACGATGGGAGGCTCTTGTAGGTGGGCCTTCTTTCCTCCCAAGTAAGAATAATGGCATCTTAGGTAG

Reverse complement sequence

CTACCTAAGATGCCATTATTCTTACTTGGGAGGAAAGAAGGCCCACCTACAAGAGCCTCCCATCGTCGTGTGGATCCATCGACCATGGCACCTACTAGTG[T/C]
CTCCATCATGCTGCAGGTTTACTAAAATGGGGCCCATACCAACCAATGCCTCCCTCCAAGCCCCGACGAGCACTGGGCGTAACATGTAAGCTGGTGGTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.90%	27.00%	2.12%	0.00%	NA
All Indica	2759	94.00%	2.70%	3.26%	0.00%	NA
All Japonica	1512	21.90%	77.50%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	88.20%	2.90%	8.91%	0.00%	NA
Indica II	465	95.90%	1.90%	2.15%	0.00%	NA
Indica III	913	96.20%	3.50%	0.33%	0.00%	NA
Indica Intermediate	786	94.80%	2.20%	3.05%	0.00%	NA
Temperate Japonica	767	2.30%	97.30%	0.39%	0.00%	NA
Tropical Japonica	504	42.70%	56.50%	0.79%	0.00%	NA
Japonica Intermediate	241	40.70%	58.50%	0.83%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0312973767	A -> G	LOC_Os03g22570.1	upstream_gene_variant ; 2364.0bp to feature; MODIFIER	silent_mutation	Average:65.057; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N
vg0312973767	A -> G	LOC_Os03g22570.2	upstream_gene_variant ; 2364.0bp to feature; MODIFIER	silent_mutation	Average:65.057; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N
vg0312973767	A -> G	LOC_Os03g22560-LOC_Os03g22570	intergenic_region ; MODIFIER	silent_mutation	Average:65.057; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0312973767	3.52E-06	3.52E-06	mr1173	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767	NA	2.07E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767	NA	1.01E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767	NA	4.20E-07	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767	NA	3.73E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767	NA	1.69E-34	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767	NA	1.39E-21	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251