\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312973767:

Variant ID: vg0312973767 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12973767
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AGACCACCAGCTTACATGTTACGCCCAGTGCTCGTCGGGGCTTGGAGGGAGGCATTGGTTGGTATGGGCCCCATTTTAGTAAACCTGCAGCATGATGGAG[A/G]
CACTAGTAGGTGCCATGGTCGATGGATCCACACGACGATGGGAGGCTCTTGTAGGTGGGCCTTCTTTCCTCCCAAGTAAGAATAATGGCATCTTAGGTAG

Reverse complement sequence

CTACCTAAGATGCCATTATTCTTACTTGGGAGGAAAGAAGGCCCACCTACAAGAGCCTCCCATCGTCGTGTGGATCCATCGACCATGGCACCTACTAGTG[T/C]
CTCCATCATGCTGCAGGTTTACTAAAATGGGGCCCATACCAACCAATGCCTCCCTCCAAGCCCCGACGAGCACTGGGCGTAACATGTAAGCTGGTGGTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.90% 27.00% 2.12% 0.00% NA
All Indica  2759 94.00% 2.70% 3.26% 0.00% NA
All Japonica  1512 21.90% 77.50% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.20% 2.90% 8.91% 0.00% NA
Indica II  465 95.90% 1.90% 2.15% 0.00% NA
Indica III  913 96.20% 3.50% 0.33% 0.00% NA
Indica Intermediate  786 94.80% 2.20% 3.05% 0.00% NA
Temperate Japonica  767 2.30% 97.30% 0.39% 0.00% NA
Tropical Japonica  504 42.70% 56.50% 0.79% 0.00% NA
Japonica Intermediate  241 40.70% 58.50% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312973767 A -> G LOC_Os03g22570.1 upstream_gene_variant ; 2364.0bp to feature; MODIFIER silent_mutation Average:65.057; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0312973767 A -> G LOC_Os03g22570.2 upstream_gene_variant ; 2364.0bp to feature; MODIFIER silent_mutation Average:65.057; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0312973767 A -> G LOC_Os03g22560-LOC_Os03g22570 intergenic_region ; MODIFIER silent_mutation Average:65.057; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312973767 3.52E-06 3.52E-06 mr1173 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767 NA 2.07E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767 NA 1.01E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767 NA 4.20E-07 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767 NA 3.73E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767 NA 1.69E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312973767 NA 1.39E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251