Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312872747:

Variant ID: vg0312872747 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 12872747
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TAATTTTGGTGTGAACTAAACATAGCCTTATAGGTAAAACTTTTATATATTTGTTCATAACGACTTAAAAGCCAATGCTAAAAATAAATTATGTCAAAAA[T/A]
ATCTTAAAATCAACTTTAAATTCAAGTTTGAAAAATCGTATGTCAACACAGGGAATATAGGCAAACCAATGAGGCTCGTACACACATACGAGACATGCCC

Reverse complement sequence

GGGCATGTCTCGTATGTGTGTACGAGCCTCATTGGTTTGCCTATATTCCCTGTGTTGACATACGATTTTTCAAACTTGAATTTAAAGTTGATTTTAAGAT[A/T]
TTTTTGACATAATTTATTTTTAGCATTGGCTTTTAAGTCGTTATGAACAAATATATAAAAGTTTTACCTATAAGGCTATGTTTAGTTCACACCAAAATTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	2.80%	1.67%	0.00%	NA
All Indica	2759	97.30%	0.20%	2.50%	0.00%	NA
All Japonica	1512	91.30%	8.10%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.80%	0.50%	6.72%	0.00%	NA
Indica II	465	96.30%	0.20%	3.44%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	0.10%	1.65%	0.00%	NA
Temperate Japonica	767	99.50%	0.30%	0.26%	0.00%	NA
Tropical Japonica	504	77.80%	21.20%	0.99%	0.00%	NA
Japonica Intermediate	241	93.80%	5.40%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0312872747	T -> A	LOC_Os03g22450.1	upstream_gene_variant ; 3455.0bp to feature; MODIFIER	silent_mutation	Average:43.581; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N
vg0312872747	T -> A	LOC_Os03g22460.1	downstream_gene_variant ; 1373.0bp to feature; MODIFIER	silent_mutation	Average:43.581; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N
vg0312872747	T -> A	LOC_Os03g22460.2	downstream_gene_variant ; 2123.0bp to feature; MODIFIER	silent_mutation	Average:43.581; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N
vg0312872747	T -> A	LOC_Os03g22470.1	intron_variant ; MODIFIER	silent_mutation	Average:43.581; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0312872747	NA	6.20E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312872747	NA	1.61E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312872747	NA	1.57E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312872747	3.50E-06	3.50E-06	mr1547_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312872747	NA	1.03E-07	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312872747	NA	7.50E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312872747	3.09E-06	3.09E-06	mr1562_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312872747	NA	5.31E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312872747	NA	8.17E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251